Clone Read LE_HBa0011C24_T7_5447

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0011C24_T7_5447
Primer
T7
ID from Seq. Facility
LE_HBa_011_C24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
846 trimmed for vector and quality, 914 raw
Genbank Accession
Sequence
>LE_HBa0011C24_T7_5447 (raw untrimmed)
GGGAAAATGGGTCCCGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTTCAATGATATAGGAAAAGACGGAGATAATAAAAAGGGATTAATGA
TTGAGATTAAGCATCTCGGTTTAAAACGTAGCCTCATTGTTCATATAATTGAGTTTCGCTCGACTGAAAAGGAGAAGGACCCTCCTCTGTTATCAATAGA
TGAACCAACCTCCAGTGCTCTCATAAAATTTACCTAATAAATGACTATATCAAAGGAAAACTTATAAAATAAATGTCAAATGAAAGATGAGAGCCCTAAA
GCAAAAAACTCTCTAAAAACATGATGAAAACCAATCTCAATAATCTCTCCGCCCCATATTAGTTGTTGATTTCCTTTTCACACGAAAATAAGAAATCATT
AAATGAGAAGATAATTTTTTATATTCACTCTTATAAAGCATCTTCATTTTTTTTATAAACAAATGCGAATACTTTGAAAATGAATAAGTTGCAAGGATAA
TATAAGAAAAATATAAATTAATGTTTTATTGATTTAGTGAAGTGAGCAACTAATATGTGACAACTACTTTTAGTACAATGACGAATTAATATAGGACAAA
TGGAGTAGAAAAAAACATAGTTAAAATAAAAACTAGTACATAGATATCTAATAAAGATGGTAAGAACAAAAACAGTTGAAAATAATTGTGTTTAAAGGTC
TTCACAATATTTGTCCCTGAAACCTAAACTAGTACCTTAATAAGAAGTTTGTACCTATGCCCGAAATCTCAGAGACACACTTCTACTATAATAAGGTCCT
ATTACCGCCCATGAACTTATTTTACAAAGAATTTTCTACCCCTTTTCGTCCTCATGTCTCTATCTTATGGGCAGTGCGTGTTGACATTTTTTAAAGTAGT
GTACGTAGGAAAAA
>LE_HBa0011C24_T7_5447 (trimmed for quality and cloning vector)
AGCTTTTTCAATGATATAGGAAAAGACGGAGATAATAAAAAGGGATTAATGATTGAGATTAAGCATCTCGGTTTAAAACGTAGCCTCATTGTTCATATAA
TTGAGTTTCGCTCGACTGAAAAGGAGAAGGACCCTCCTCTGTTATCAATAGATGAACCAACCTCCAGTGCTCTCATAAAATTTACCTAATAAATGACTAT
ATCAAAGGAAAACTTATAAAATAAATGTCAAATGAAAGATGAGAGCCCTAAAGCAAAAAACTCTCTAAAAACATGATGAAAACCAATCTCAATAATCTCT
CCGCCCCATATTAGTTGTTGATTTCCTTTTCACACGAAAATAAGAAATCATTAAATGAGAAGATAATTTTTTATATTCACTCTTATAAAGCATCTTCATT
TTTTTTATAAACAAATGCGAATACTTTGAAAATGAATAAGTTGCAAGGATAATATAAGAAAAATATAAATTAATGTTTTATTGATTTAGTGAAGTGAGCA
ACTAATATGTGACAACTACTTTTAGTACAATGACGAATTAATATAGGACAAATGGAGTAGAAAAAAACATAGTTAAAATAAAAACTAGTACATAGATATC
TAATAAAGATGGTAAGAACAAAAACAGTTGAAAATAATTGTGTTTAAAGGTCTTCACAATATTTGTCCCTGAAACCTAAACTAGTACCTTAATAAGAAGT
TTGTACCTATGCCCGAAATCTCAGAGACACACTTCTACTATAATAAGGTCCTATTACCGCCCATGAACTTATTTTACAAAGAATTTTCTACCCCTTTTCG
TCCTCATGTCTCTATCTTATGGGCAGTGCGTGTTGACATTTTTTAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.932479
Expected error %
0.676982
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0011C24
Clone
Clone name
hba-11c24
LE_HBa0011C24
P011C24
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found