Clone Read LE_HBa0011D23_T7_5470

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0011D23_T7_5470
Primer
T7
ID from Seq. Facility
LE_HBa_011_D23-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
805 trimmed for vector and quality, 888 raw
Genbank Accession
Sequence
>LE_HBa0011D23_T7_5470 (raw untrimmed)
TCCAAACTTGGTCCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCCATGGCATGCTGGATTTCACTGTGAGCAGAGTGGGGCATTGAGGGA
TAAAAACGATGTCGCTTTTAGTAAACTTGCTGAGGGTGAAAAATGGCAGAGGTGTCCTAAGTGTCGCTCTTTTGTTCAACTTAGTGAAGGTTGCCGTCAT
ATCACTTGCAGGTTAGTATATAGACTTTTAATATTTAATTATTTTTGTGTTTATAATTTAATCTAATTGTGTTTTTATGTAGGTGTCAAGCCAATTTTTG
TTACGATTGCGGAATGCTATTCGATAAATCCCATGGCTTGTGTGCTTGTGATTCTCAGTTAATTACCTTCAACCGTATTATTGACTTGCGATTTGGTAAC
TGGAGATTTTTGTTCTGACTGATTTTGGGCCAATTTTATAATTGTAGTGAAGTGTTTGAGTTTTTTTTTTTTAAACTACTTTTTCTATGATCAAAGGAAT
GATCGTTTTAGGTTTTCTTCTTATAATATGATTGTAATTTGTAGGAGTACTATTTTCCCCAAAATTTTCTTTCACGTATGACTTTTGCAGTTATCCATCT
TTTTCAAAATCAGCTGAGCTTTATTGGAATCGGAATATCATAAAAGGTTAACAATTTCTTTTGTTTATTTATAAGTTATTCTTAATCCCTCTATTCACTT
CTATTTATTACTCAGAAAGGAACTTTTAAATTTTTACTTCTTAATTAAAATTTTATCAAAATATTATTTAATTTTATGATTTTTAACATACCATATGAAA
AGTTAAAAGTATTTCAAAAAAATAAGAAATCATTATTTTTGAACAGACTAAAAATAAATGATTCTTTTATTTTTAACAGAAGAAGTAT
>LE_HBa0011D23_T7_5470 (trimmed for quality and cloning vector)
AGCTTCCATGGCATGCTGGATTTCACTGTGAGCAGAGTGGGGCATTGAGGGATAAAAACGATGTCGCTTTTAGTAAACTTGCTGAGGGTGAAAAATGGCA
GAGGTGTCCTAAGTGTCGCTCTTTTGTTCAACTTAGTGAAGGTTGCCGTCATATCACTTGCAGGTTAGTATATAGACTTTTAATATTTAATTATTTTTGT
GTTTATAATTTAATCTAATTGTGTTTTTATGTAGGTGTCAAGCCAATTTTTGTTACGATTGCGGAATGCTATTCGATAAATCCCATGGCTTGTGTGCTTG
TGATTCTCAGTTAATTACCTTCAACCGTATTATTGACTTGCGATTTGGTAACTGGAGATTTTTGTTCTGACTGATTTTGGGCCAATTTTATAATTGTAGT
GAAGTGTTTGAGTTTTTTTTTTTTAAACTACTTTTTCTATGATCAAAGGAATGATCGTTTTAGGTTTTCTTCTTATAATATGATTGTAATTTGTAGGAGT
ACTATTTTCCCCAAAATTTTCTTTCACGTATGACTTTTGCAGTTATCCATCTTTTTCAAAATCAGCTGAGCTTTATTGGAATCGGAATATCATAAAAGGT
TAACAATTTCTTTTGTTTATTTATAAGTTATTCTTAATCCCTCTATTCACTTCTATTTATTACTCAGAAAGGAACTTTTAAATTTTTACTTCTTAATTAA
AATTTTATCAAAATATTATTTAATTTTATGATTTTTAACATACCATATGAAAAGTTAAAAGTATTTCAAAAAAATAAGAAATCATTATTTTTGAACAGAC
TAAAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.920332
Expected error %
0.661894
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0011D23
Clone
Clone name
hba-11d23
LE_HBa0011D23
P011D23
Clone type
BAC
Contamination
none
Estimated length
90,601
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found