Clone Read LE_HBa0062O05_SP6_54824

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0062O05_SP6_54824
Primer
SP6
ID from Seq. Facility
LE_HBa_062_O05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
491 trimmed for vector and quality, 812 raw
Sequence
>LE_HBa0062O05_SP6_54824 (raw untrimmed)
CCAAGGTTTTGACACCTTTGGGAATTGCTTAGGTCCTATGAAGACTTTCAAGACACCTNAGTTTGGATAATAAGAACTGAAGTTGAGTTTTTCACAAATC
TTTAGTCAATAAGTCTTCCAGTTGATCATGTATTTTCCTGATAAAGTGACAATCTATTTCGATATGTTTAGTTCTCTCATGAAATACTAGATCTGCAGCT
ATTTGAATAGTCGCTTTGCTATCATAGTAGATTGATATCAGTCCTTCAATCTAATTTCCACTTCCTTAGTAGGTTTGTGACCCAGACTACCTCAGTTGTT
AAGCCTGCTAAAGTTCTATACTCAACTTCTGTTGAACTTTTGCTTAGATTTCCAGGCAATGACAGAGTCACCAAGTTTGAGGATGTGACATGTTACAGTC
TGGCCCAATTAGCATCACAATACCATGTTAGTTTCATGTCCTTCTCTGATGACATTAGTAATCCCAGCCCTGATTGAGTCTTAATATACTATAGAACTCT
CAATGCCGCATTATAATGTTTCACTATAGGTCTCTGTCTAAATTGACTTAATGTTTATACTGTGTAGGCAATATCAAATGGTTAGGTAATGAAGTTTGCG
CATCATTTTTTATGGTTTTACTTTTCCAAATTACTTAAACCTTACTCAGGTTGTCTCCTGCATTATGTCTATTGCATTTCTACTTGGTTTTAATGATTTA
GTCTCGAACGTTGTTAAATGGTACTTCGCTCATAATTAGATCTATCTTTTCCTTAATATTTCTTGTATATTGTCTACCGTCATAATTTTTAGACTATACG
GATTAGTTAATA
>LE_HBa0062O05_SP6_54824 (trimmed for quality and cloning vector)
TGCTTAGGTCCTATGAAGACTTTCAAGACACCTNAGTTTGGATAATAAGAACTGAAGTTGAGTTTTTCACAAATCTTTAGTCAATAAGTCTTCCAGTTGA
TCATGTATTTTCCTGATAAAGTGACAATCTATTTCGATATGTTTAGTTCTCTCATGAAATACTAGATCTGCAGCTATTTGAATAGTCGCTTTGCTATCAT
AGTAGATTGATATCAGTCCTTCAATCTAATTTCCACTTCCTTAGTAGGTTTGTGACCCAGACTACCTCAGTTGTTAAGCCTGCTAAAGTTCTATACTCAA
CTTCTGTTGAACTTTTGCTTAGATTTCCAGGCAATGACAGAGTCACCAAGTTTGAGGATGTGACATGTTACAGTCTGGCCCAATTAGCATCACAATACCA
TGTTAGTTTCATGTCCTTCTCTGATGACATTAGTAATCCCAGCCCTGATTGAGTCTTAATATACTATAGAACTCTCAATGCCGCATTATAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.95641
Expected error %
0.819731
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23160.1 Score 46 E Value 3e-13 Identity 37.20% Align. Length 375bp (76.37%) Frame 2
68417.m03342 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89728.1| Score 61 E Value 4e-19 Identity 39.80% Align. Length 375bp (76.37%) Frame 2
putative retroelement pol polyprotein-like [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT39941.1| Score 54 E Value 5e-16 Identity 43.40% Align. Length 369bp (75.15%) Frame 2
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0062O05
Clone
Clone name
hba-62o5
LE_HBa0062O05
P062O05
Clone type
BAC
Contamination
none
Estimated length
83,827
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found