Clone Read LE_HBa0062O05_T7_54825

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0062O05_T7_54825
Primer
T7
ID from Seq. Facility
LE_HBa_062_O05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
526 trimmed for vector and quality, 816 raw
Sequence
>LE_HBa0062O05_T7_54825 (raw untrimmed)
CCTGGGACCCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTATGCCAAGTTCTCTAAGTGTGTGTTTTGGCTAGATGCAGTGTCCTTCTTG
GGGCACGTGGTTTCTAAGGATGGAGTGATGGTGGATCCTTCTAAGATTGAGACAGTAAAGAATTGGGTAAGACCTACTAATATGTCAGAAATAAGGAGCT
TTGTTGGGTTAGCTAGCTACTACCGCCGATTTGTCAAGGGATTCTCTTCTATTGCTTGCCAACTGACGAACTTGACTAAGCAAAATGTTCCATTTGTATG
GTCGGATGAGTGTGAAGAAAGCTTTCAGAAGCTCAAGACTTTGTTGACTACCGCACCCATTCTCACCTTGCCAGTGGAAGGTAAGAATTTCATTGTCTCT
TGTGATGCATCCTATTCGGGTTTGGGTGCAGTGCTAATACAAGAGAAGAATGTAATTGCTTATGCTTCAAGACAATTAAAAGTGCATGAACGTAACTACC
CAACTCATGATTTGGAATTGGCCGCGGTAGTGTTTGCATTAAAGCAATGGAGACACTATTTATATGGGGTTAAGTGTGAGGCCTATACTGATCTTCATAG
CCTTCAGTATGTCTTTACTTCATTTAAGATTTGAATTTTTATACGTATATAGTAATGTGTTATCTTCTTTATTTACTCCCATATTCTTTCCTTTGTTTTA
TCCGGTCTAATGCCAATGCTGTATCCCGTTGTTTTTCGTATTTTTGATGGTAAGGTTGGGGTACGTCTATCTTCAACTTCTTCTTCTCCTTGATCTTCCT
TCTTTGTTAACATTGT
>LE_HBa0062O05_T7_54825 (trimmed for quality and cloning vector)
AGCTTTATGCCAAGTTCTCTAAGTGTGTGTTTTGGCTAGATGCAGTGTCCTTCTTGGGGCACGTGGTTTCTAAGGATGGAGTGATGGTGGATCCTTCTAA
GATTGAGACAGTAAAGAATTGGGTAAGACCTACTAATATGTCAGAAATAAGGAGCTTTGTTGGGTTAGCTAGCTACTACCGCCGATTTGTCAAGGGATTC
TCTTCTATTGCTTGCCAACTGACGAACTTGACTAAGCAAAATGTTCCATTTGTATGGTCGGATGAGTGTGAAGAAAGCTTTCAGAAGCTCAAGACTTTGT
TGACTACCGCACCCATTCTCACCTTGCCAGTGGAAGGTAAGAATTTCATTGTCTCTTGTGATGCATCCTATTCGGGTTTGGGTGCAGTGCTAATACAAGA
GAAGAATGTAATTGCTTATGCTTCAAGACAATTAAAAGTGCATGAACGTAACTACCCAACTCATGATTTGGAATTGGCCGCGGTAGTGTTTGCATTAAAG
CAATGGAGACACTATTTATATGGGGT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.974157
Expected error %
0.293795
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 248 E Value 4e-65 Identity 22.60% Align. Length 521bp (99.05%) Frame 1
putative polyprotein, 3'-partial [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 247 E Value 1e-64 Identity 22.60% Align. Length 521bp (99.05%) Frame 1
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0062O05
Clone
Clone name
hba-62o5
LE_HBa0062O05
P062O05
Clone type
BAC
Contamination
none
Estimated length
83,827
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found