Clone Read LE_HBa0074B07_SP6_54972

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0074B07_SP6_54972
Primer
SP6
ID from Seq. Facility
LE_HBa_074_B07-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
781 trimmed for vector and quality, 912 raw
Genbank Accession
Sequence
>LE_HBa0074B07_SP6_54972 (raw untrimmed)
CCCGAGCATCCTTGAAATTTTTATGGGCGATTATCATTGCCTCATTATTTTGTTTATAATATTACAAATTTAGATGTCCATATTTTGAATTAAATAATTT
TGTCAAAGAAAGAAAGAAGCTGGCAAAAGTGGTCCCACTCGTTCGGTGTTCACATTAGAGTTCGAACACATTTGGACGGTAAGACTCAAATTCGAAACCT
TTTAGCTAAATGAAGGAATATTTATCACAGTGTTATGTTAGGTTTTATTTATTCTAAAAATCTTATCAAAAATTGGTTTTTCTTTTAGGAAAAGTTTTTT
GATTGACTATTATTTTTTTAGTAGGAAAAAGTTTAGAACTCTATAAATAGAGTCATGTTCCTTCTAACTTAATCAGCATTTACAATGCAGTCTTAAAGGT
TTTGAGAGTTTTGACTAGGGGGAGAACTTATGAGTCACAAGTTTGATACGTTATCACTTGTGTGAACCTCCCATGTATTTCGAGTGAATTGGTTAAGGTT
GTTTCTCTCTGTATTTTGTACTATCATATTTATAGTGGATTTGCTCATCTCATTTGTGGACGTAGGTTGATTGACCGAACCACGCTAAGTCTTTATGTCT
TTTGGTATATTTCTCGTTGTCTTCTTATTCGTGGTCTTTTAAGGTTTGCTTTGCTAGCTTCCGCGTTTACACCTGCTTATTTTCGGTCCTAACATGTATC
ATAGTCCTTGTTGATATGAGTTTTGATTTTATTGTTTTGATCATTATTCTTCCAGTTCAATAATAGTCGTCCACTTGACGAAATTAATGAACAATGTTAT
AGTTAGTTTTTAATTTATCCTAATATTAATTATACTCATTTTCTTATTACATTTTTCAATACTTGGTATTTACTATATTCAAAGAGTAATAATTGTAAAA
TTATCCTTCTAT
>LE_HBa0074B07_SP6_54972 (trimmed for quality and cloning vector)
CGATTATCATTGCCTCATTATTTTGTTTATAATATTACAAATTTAGATGTCCATATTTTGAATTAAATAATTTTGTCAAAGAAAGAAAGAAGCTGGCAAA
AGTGGTCCCACTCGTTCGGTGTTCACATTAGAGTTCGAACACATTTGGACGGTAAGACTCAAATTCGAAACCTTTTAGCTAAATGAAGGAATATTTATCA
CAGTGTTATGTTAGGTTTTATTTATTCTAAAAATCTTATCAAAAATTGGTTTTTCTTTTAGGAAAAGTTTTTTGATTGACTATTATTTTTTTAGTAGGAA
AAAGTTTAGAACTCTATAAATAGAGTCATGTTCCTTCTAACTTAATCAGCATTTACAATGCAGTCTTAAAGGTTTTGAGAGTTTTGACTAGGGGGAGAAC
TTATGAGTCACAAGTTTGATACGTTATCACTTGTGTGAACCTCCCATGTATTTCGAGTGAATTGGTTAAGGTTGTTTCTCTCTGTATTTTGTACTATCAT
ATTTATAGTGGATTTGCTCATCTCATTTGTGGACGTAGGTTGATTGACCGAACCACGCTAAGTCTTTATGTCTTTTGGTATATTTCTCGTTGTCTTCTTA
TTCGTGGTCTTTTAAGGTTTGCTTTGCTAGCTTCCGCGTTTACACCTGCTTATTTTCGGTCCTAACATGTATCATAGTCCTTGTTGATATGAGTTTTGAT
TTTATTGTTTTGATCATTATTCTTCCAGTTCAATAATAGTCGTCCACTTGACGAAATTAATGAACAATGTTATAGTTAGTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.934579
Expected error %
0.066122
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0074B07
Clone
Clone name
hba-74b7
LE_HBa0074B07
P074B07
Clone type
BAC
Contamination
none
Estimated length
84,719
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found