Clone Read LE_HBa0074B07_T7_54973

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0074B07_T7_54973
Primer
T7
ID from Seq. Facility
LE_HBa_074_B07-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
759 trimmed for vector and quality, 891 raw
Genbank Accession
Sequence
>LE_HBa0074B07_T7_54973 (raw untrimmed)
TTTAGCCTGGGCCCGGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATGATGCTGCAGCTCGAACTCTTCGTGGACCTAAAGCTAAAACTAAT
TTCCCTTTACCTATGTATTCTCAGCATCATCAGTTCAATCGAAGTTTAAACCCTAATGATCGGTTAGTTGACCCGAGATTGTACTCACAAGAAGCTCCGA
TCATTTGTCAAAGACCTACATCGAGCAGTATGAGTAGTACTGTGGAATCATTCAGTGGACCGAGACCGCCACGTCAGCAAACGGCGGTTTTGCCTTCGAG
AAAACATCCTAGATCGCCGCCGGTTGAGCCGGATGACTGCAGGAGTGATTGTGACTCATCGTCTTCTGTTGTTGAAGATGGTGATTGTGAAGGGGGAAAT
GACAACATCGTTTCTTCATCTCTCAGAAATCCACTGCCTTTCGATCTCAACTTTCCACCTCCGATGGATGATGTTTATGCTAATTCAAATGATCTTTACT
GCACAGCACTATGTCTTTGAAGGAAAATGGTTTCAAAGTTTCAATCTTTCAATTATATTGAAACACACAAAAAAAATCACAGATTTAAAGCAATTGCTAT
GAATCTGTTGCTGGAAGAGATTTTAACTCTTCCATTTACTTATCCCTATTTAATGTCATGGTATTTCATGATAGATGGATTAGTGTCTGACAATTGATCT
GATTATGTGTCCTTCCACTATATATGAGTTTTGGGATAATGTAGTCTTTTATTGTCAGATTTATATACTTTACCATGTAAAATTAGAGGGAACTTTCCGT
TCTGTGTTGGACCTATTACACGATAGCTTCTAGGGCGTCGATGAAAGACATATCTACTCCTTCATCCACTAATGTAAAACCACACACTCTC
>LE_HBa0074B07_T7_54973 (trimmed for quality and cloning vector)
AGCTTATGATGCTGCAGCTCGAACTCTTCGTGGACCTAAAGCTAAAACTAATTTCCCTTTACCTATGTATTCTCAGCATCATCAGTTCAATCGAAGTTTA
AACCCTAATGATCGGTTAGTTGACCCGAGATTGTACTCACAAGAAGCTCCGATCATTTGTCAAAGACCTACATCGAGCAGTATGAGTAGTACTGTGGAAT
CATTCAGTGGACCGAGACCGCCACGTCAGCAAACGGCGGTTTTGCCTTCGAGAAAACATCCTAGATCGCCGCCGGTTGAGCCGGATGACTGCAGGAGTGA
TTGTGACTCATCGTCTTCTGTTGTTGAAGATGGTGATTGTGAAGGGGGAAATGACAACATCGTTTCTTCATCTCTCAGAAATCCACTGCCTTTCGATCTC
AACTTTCCACCTCCGATGGATGATGTTTATGCTAATTCAAATGATCTTTACTGCACAGCACTATGTCTTTGAAGGAAAATGGTTTCAAAGTTTCAATCTT
TCAATTATATTGAAACACACAAAAAAAATCACAGATTTAAAGCAATTGCTATGAATCTGTTGCTGGAAGAGATTTTAACTCTTCCATTTACTTATCCCTA
TTTAATGTCATGGTATTTCATGATAGATGGATTAGTGTCTGACAATTGATCTGATTATGTGTCCTTCCACTATATATGAGTTTTGGGATAATGTAGTCTT
TTATTGTCAGATTTATATACTTTACCATGTAAAATTAGAGGGAACTTTCCGTTCTGTGT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.971083
Expected error %
0.772381
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g50640.1 Score 73 E Value 1e-13 Identity 12.20% Align. Length 467bp (61.53%) Frame 3
68414.m05692 ethylene-responsive element-binding factor 3 (ERF3) identical to SP|O80339 Ethylene responsive element binding factor 3 (AtERF3) [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV54034.1| Score 127 E Value 8e-42 Identity 70.20% Align. Length 513bp (67.59%) Frame 3
ethylene-responsive element binding protein 6 [Nicotiana tabacum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
sp|Q9SXS8|ERF3_TOBAC Score 122 E Value 1e-26 Identity 16.70% Align. Length 467bp (61.53%) Frame 3
Ethylene-responsive transcription factor 3 (Ethylene-responsive element binding factor 3 homolog) (EREBP-5) (NtERF5) dbj|BAA76734.1| ethylene responsive element binding factor [Nicotiana tabacum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0074B07
Clone
Clone name
hba-74b7
LE_HBa0074B07
P074B07
Clone type
BAC
Contamination
none
Estimated length
84,719
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found