Clone Read LE_HBa0011F13_T7_5508

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0011F13_T7_5508
Primer
T7
ID from Seq. Facility
LE_HBa_011_F13-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
926 trimmed for vector and quality, 990 raw
Genbank Accession
Sequence
>LE_HBa0011F13_T7_5508 (raw untrimmed)
GCCATATTGGGGACCGGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTTCAAGGGTGTTTTGGTCATCTTATAGGAATTACTTTGTGTGTGA
ATATCAAACTTTTGGTACAACAACAGCATCGATAAAACAGTGTGAGCATTTTGCAACAGTAGATTTCTTCTGCATATGACGTATGGTTATTACTTTTTGT
TTTATTATATAATGTTTCCATATTTAAAATTAAATTCAATTGATTGTGAGTCCAAAATTTCATCTTACGAATTATGATATAATATACTACATGATAAAAA
TTAATTTAAACTCCAAATTTAAATTTAAAAAAATAAAAAGATACTTACAACTCAATCCCACGTAGCACTCCTAAAAACAAAATCCTAACTCATATTTGAT
TATATAATAATACTAACATAAACTATATATAGATTAACCCAAAAATTCTTTTACAGCACAAAATAAGAGGGTCCAATTGTTATTTGTGGTGAAAAAGTTA
TCAACTTATATGACACATAAATAAAGAGGAGTAATAATTTGCTGACCAGCCTTAAATGTTCTCTTCTCACATGACCCCCACCCCACCCCCTCCAAATATA
TATTTTTTTCTTTTAAAAAAAAAGAGCAATATTTTGAGTAATTATAGTTCAATAACGAACAAAAAATTGTAGGATTAGTTCTAATTAATGTGGCAGTGGA
GAACTAATCATGAGATGCATGCTAATAACAACATGGATTACATGATCAGTCATGTGTCTTGTTCTCTTAAACACAAGATTGGAAATACAAACATTTAACC
ACTAAAGTTAGCACTTTAATTTTGGGTACATATTTGGGGGTCTACCAGAACAAACATCACTTTTATTAATTTTCAATTTACAATATTATTTTTTTAACAA
CCAGCTATCCATAAAATGAACATTTTAGAGGAAAAGATTTTATTTTATACTGCTTAAAAATTTTCATTGGCAATTGATAATAAAATAAAT
>LE_HBa0011F13_T7_5508 (trimmed for quality and cloning vector)
AGCTTGTTCAAGGGTGTTTTGGTCATCTTATAGGAATTACTTTGTGTGTGAATATCAAACTTTTGGTACAACAACAGCATCGATAAAACAGTGTGAGCAT
TTTGCAACAGTAGATTTCTTCTGCATATGACGTATGGTTATTACTTTTTGTTTTATTATATAATGTTTCCATATTTAAAATTAAATTCAATTGATTGTGA
GTCCAAAATTTCATCTTACGAATTATGATATAATATACTACATGATAAAAATTAATTTAAACTCCAAATTTAAATTTAAAAAAATAAAAAGATACTTACA
ACTCAATCCCACGTAGCACTCCTAAAAACAAAATCCTAACTCATATTTGATTATATAATAATACTAACATAAACTATATATAGATTAACCCAAAAATTCT
TTTACAGCACAAAATAAGAGGGTCCAATTGTTATTTGTGGTGAAAAAGTTATCAACTTATATGACACATAAATAAAGAGGAGTAATAATTTGCTGACCAG
CCTTAAATGTTCTCTTCTCACATGACCCCCACCCCACCCCCTCCAAATATATATTTTTTTCTTTTAAAAAAAAAGAGCAATATTTTGAGTAATTATAGTT
CAATAACGAACAAAAAATTGTAGGATTAGTTCTAATTAATGTGGCAGTGGAGAACTAATCATGAGATGCATGCTAATAACAACATGGATTACATGATCAG
TCATGTGTCTTGTTCTCTTAAACACAAGATTGGAAATACAAACATTTAACCACTAAAGTTAGCACTTTAATTTTGGGTACATATTTGGGGGTCTACCAGA
ACAAACATCACTTTTATTAATTTTCAATTTACAATATTATTTTTTTAACAACCAGCTATCCATAAAATGAACATTTTAGAGGAAAAGATTTTATTTTATA
CTGCTTAAAAATTTTCATTGGCAATT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.916354
Expected error %
1.81593
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0011F13
Clone
Clone name
hba-11f13
LE_HBa0011F13
P011F13
Clone type
BAC
Contamination
none
Estimated length
88,411
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found