Clone Read LE_HBa0074H18_SP6_55282

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0074H18_SP6_55282
Primer
SP6
ID from Seq. Facility
LE_HBa_074_H18-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
628 trimmed for vector and quality, 879 raw
Genbank Accession
Sequence
>LE_HBa0074H18_SP6_55282 (raw untrimmed)
GGGCGCAGATTTTTTTCTGTTCTTCCCTCGCTCGATTCTCCCTCTCTCTCTTGTTCTTTCTATTTTCTTATTCAAACCCTCTTTCTTTTACCCTAATTAG
TATATAATTAAGAATAAAAAATGGCAATAATAACCCACTAATTAACTTAAGGTTACCTCTTTTAACCCCCAAGTAATTAGACTTATTAACATTAACCCTC
TAACTTTAAAATTAAAGTAGGAATAGTCCAAAACGTCCCTTAAAACGTATAAAGAAATCCGACCCAGACTGGGATTACGCAGTCTGTGACGGCCCGTCGC
ACCTGCGACGGTCTGTTCTGCTGCTCCGTCACAGACTTCAGAGACTCAATTTCTCTGAAGGGTCTATGACGGTCCGTCACACCTGTGACGGTCCGTCCTG
CCATTCCGTTACGAAGTTCAGAGAGTCGATTTTCAGTACCCAATTTCAGATTTTCTAAATGTTTTGAAACGAGACCCTGCGACGGTCCGTCGTGCCCATG
ACGGTCCGTCGTGGGATCCATCGCCTCAGCCTGTTTTTTCCAGAAATAAAATCTGCTGCTCAAAACGACTAAACAGGTCGTTACATTTCAAAAAGTTTGA
AAATTCCATACATAAATATCTAGTCAAAGTTAAATTGTTTGACTCTCAAAAAACTAAAAGTATCGTATAAAATAAGACAGAAAATTTTATTTTCCAACGC
TCTCAAAGAGATCAAGATAAGATCACATTTAAAATATAAAAACTAAAAATACGAATAGCAATTTCATAAAATACCTTTATTTATTTATTTTCAAGAGAAC
ATTAATACACTCAACATGATACCTAAACCTTAAAGCGGCACAACATGAATACCATCAATGTGTAATGTCCTAGAGAAAA
>LE_HBa0074H18_SP6_55282 (trimmed for quality and cloning vector)
CCTCTCTCTCTTGTTCTTTCTATTTTCTTATTCAAACCCTCTTTCTTTTACCCTAATTAGTATATAATTAAGAATAAAAAATGGCAATAATAACCCACTA
ATTAACTTAAGGTTACCTCTTTTAACCCCCAAGTAATTAGACTTATTAACATTAACCCTCTAACTTTAAAATTAAAGTAGGAATAGTCCAAAACGTCCCT
TAAAACGTATAAAGAAATCCGACCCAGACTGGGATTACGCAGTCTGTGACGGCCCGTCGCACCTGCGACGGTCTGTTCTGCTGCTCCGTCACAGACTTCA
GAGACTCAATTTCTCTGAAGGGTCTATGACGGTCCGTCACACCTGTGACGGTCCGTCCTGCCATTCCGTTACGAAGTTCAGAGAGTCGATTTTCAGTACC
CAATTTCAGATTTTCTAAATGTTTTGAAACGAGACCCTGCGACGGTCCGTCGTGCCCATGACGGTCCGTCGTGGGATCCATCGCCTCAGCCTGTTTTTTC
CAGAAATAAAATCTGCTGCTCAAAACGACTAAACAGGTCGTTACATTTCAAAAAGTTTGAAAATTCCATACATAAATATCTAGTCAAAGTTAAATTGTTT
GACTCTCAAAAAACTAAAAGTATCGTAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.970608
Expected error %
0.145918
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0074H18
Clone
Clone name
hba-74h18
LE_HBa0074H18
P074H18
Clone type
BAC
Contamination
none
Estimated length
105,528
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found