Clone Read LE_HBa0074K04_SP6_55398

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0074K04_SP6_55398
Primer
SP6
ID from Seq. Facility
LE_HBa_074_K04-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
719 trimmed for vector and quality, 901 raw
Genbank Accession
Sequence
>LE_HBa0074K04_SP6_55398 (raw untrimmed)
GGCCCAGCTTTCCCGTACCAGACATTTGACAGACATGATGTTTCCTTTTCTTCAGGAAGAGAATCGGGCACGAGATCCTTTCGGTGCTCTTTGGGTGCCA
GATCTATTTATGCAAAGACTTTAAAGCAATGGGATATGGTCTTTGTTTTGTCCAAATGAGGCTCCTGGATTGGCAGATTGCTGGGGTGAAGATTTTGAGA
AGCTGTACACAAAATATGAAAAAGAGGTAAAAATAAGTGTTCTACTGAGGTTAATTGCACACCATTTATTTGATATATTAAAGATCATTCAGCATTGATC
GTTAACAATATTCTTTTGTCAACTCAGGGAAAGGCAAAGAAGGTCGTTCAAGCACAAAATCTCTGGTTTGAGATCTTAAAGTCCCAGATAGAAACTGGGA
CCCCTTACATGTTGTACAAGGTGATTTTCATGCATTCTGTTATGCTTCTCATTGTTTGTTGTGATGCAGTTAATTTTACTCTACCTTTATCTGTTTGTTA
TTGTAGGATTCTTGCAATAGAAAAAGCAACCAGCAGAATCTTGGCACTATCAAGTCTTCTAACTTGTGTACAGAGATTATTGAGTACACTAGTCCAACTG
AAACTGCTGTTTGCAATCTTGCTTCAATTGCTCTACCTAGATATGTTAGAGAGAAGGTAGTTAACATTGGTATATACTTAAAAACTTACTTGTCCTACTT
TCTCCTTGCCTCTTAGTGTAGTGTTTGCCTTTATATCTTTCAGGGGGTCCCAGGTGAATCACAGCCATCTAAGCTGGTGGGGAAGTAGGGGTTCAAAAAT
CCATCCTTGATTTTTAACAATTGGCAAAGGTTTGTTTTGTTCTAAAACCCACTTCCTTGAACTGTTTCTCTTGAAATTTTTCTAAATTTTGCTCCGTTCC
C
>LE_HBa0074K04_SP6_55398 (trimmed for quality and cloning vector)
ACATGATGTTTCCTTTTCTTCAGGAAGAGAATCGGGCACGAGATCCTTTCGGTGCTCTTTGGGTGCCAGATCTATTTATGCAAAGACTTTAAAGCAATGG
GATATGGTCTTTGTTTTGTCCAAATGAGGCTCCTGGATTGGCAGATTGCTGGGGTGAAGATTTTGAGAAGCTGTACACAAAATATGAAAAAGAGGTAAAA
ATAAGTGTTCTACTGAGGTTAATTGCACACCATTTATTTGATATATTAAAGATCATTCAGCATTGATCGTTAACAATATTCTTTTGTCAACTCAGGGAAA
GGCAAAGAAGGTCGTTCAAGCACAAAATCTCTGGTTTGAGATCTTAAAGTCCCAGATAGAAACTGGGACCCCTTACATGTTGTACAAGGTGATTTTCATG
CATTCTGTTATGCTTCTCATTGTTTGTTGTGATGCAGTTAATTTTACTCTACCTTTATCTGTTTGTTATTGTAGGATTCTTGCAATAGAAAAAGCAACCA
GCAGAATCTTGGCACTATCAAGTCTTCTAACTTGTGTACAGAGATTATTGAGTACACTAGTCCAACTGAAACTGCTGTTTGCAATCTTGCTTCAATTGCT
CTACCTAGATATGTTAGAGAGAAGGTAGTTAACATTGGTATATACTTAAAAACTTACTTGTCCTACTTTCTCCTTGCCTCTTAGTGTAGTGTTTGCCTTT
ATATCTTTCAGGGGGTCCC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.953157
Expected error %
0.271635
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g21790.1 Score 103 E Value 3e-35 Identity 47.70% Align. Length 609bp (84.70%) Frame 1
68415.m02590 ribonucleoside-diphosphate reductase small chain, putative / ribonucleotide reductase, putative similar to ribonucleotide reductase GI:4151068 from [Nicotiana tabacum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_910560.1| Score 105 E Value 8e-37 Identity 50.60% Align. Length 624bp (86.79%) Frame 1
ESTs C27722(C52692),AU058088(S0509) correspond to a region of the predicted gene.~Similar to Arabidopsis thaliana ribonucleoside-diphosphate reductase large subunit mRNA, complete cds.(AF092841) [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|EAL39294.1| Score 93 E Value 3e-43 Identity 69.00% Align. Length 600bp (83.45%) Frame 1
ENSANGP00000025683 [Anopheles gambiae str. PEST] ref|XP_554103.1| ENSANGP00000025683 [Anopheles gambiae str. PEST]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0074K04
Clone
Clone name
hba-74k4
LE_HBa0074K04
P074K04
Clone type
BAC
Contamination
none
Estimated length
136,919
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found