Clone Read LE_HBa0074L22_T7_55483

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0074L22_T7_55483
Primer
T7
ID from Seq. Facility
LE_HBa_074_L22-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
782 trimmed for vector and quality, 881 raw
Sequence
>LE_HBa0074L22_T7_55483 (raw untrimmed)
CGTAACCTGGTTACCGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTNGGATATTATTTTCGAGCACTAGAACGAAACCCATTCTTACCACAA
GCTTTTAATAATATGGCCGTGATCTGTCATTACGTGCGACTATCTCCACTATAGAAAGAAAAAAAGAAAAATCTAGTAAAGTAACTACTAGAACCAAATA
GGCTTTCTACATATGCATCGTCTAAAACAACGATTTTTATCAGCTGTAGCAAAGAACGAAACTTCATAGAAGTCAAAATAGGAAAAAATAAAAATGCCTA
GCAACTTTTTTCTATGGATATAAAGCTTTAATTGAGAGAGATAGAGGAAGCACCGTAAAGATCAATTAGCGAGGTTTTGGGCCGATACAATAATAACTGC
GTACTTATCTCATGATGTGAGATAAAAATTAGGAATTAACTTATGTAATAGAGTCGATCCACTAAAGTCTTGAGCAGCGGTGTAGGATCAGATCCCAAAG
ATAGTAAGTATTTTCTTTCTTATGAAAGAAAGTCTTTTTCAAAGATTCTATATAAATTTATCTATGAAACCGAGATAGTTCCCTTTCAGAAAATTCTAAC
ACTAGTAGAAATGCCTATGCTTTATTCTTCTGAAGGTGGGAAAAAAGATAAAACTAAATAAACGGATTATTCATCCAAATTTCAGTTTGAAACTCATGTA
ATTAACCTATTTTTCTTTTGGTTAACCCTAAAACTGGGATAGATCCATGAGAAATCTGATTATATTTTATTAGATATGGTATAGATCAAAATGGGACACC
AAAAGAATTGACTGCTGAGCCGTATGAGGTAAGAAATTCTCCAGTACGGTTCTAAGGGAAGGAATTGAACTACCTATTCCG
>LE_HBa0074L22_T7_55483 (trimmed for quality and cloning vector)
AGCTTTNGGATATTATTTTCGAGCACTAGAACGAAACCCATTCTTACCACAAGCTTTTAATAATATGGCCGTGATCTGTCATTACGTGCGACTATCTCCA
CTATAGAAAGAAAAAAAGAAAAATCTAGTAAAGTAACTACTAGAACCAAATAGGCTTTCTACATATGCATCGTCTAAAACAACGATTTTTATCAGCTGTA
GCAAAGAACGAAACTTCATAGAAGTCAAAATAGGAAAAAATAAAAATGCCTAGCAACTTTTTTCTATGGATATAAAGCTTTAATTGAGAGAGATAGAGGA
AGCACCGTAAAGATCAATTAGCGAGGTTTTGGGCCGATACAATAATAACTGCGTACTTATCTCATGATGTGAGATAAAAATTAGGAATTAACTTATGTAA
TAGAGTCGATCCACTAAAGTCTTGAGCAGCGGTGTAGGATCAGATCCCAAAGATAGTAAGTATTTTCTTTCTTATGAAAGAAAGTCTTTTTCAAAGATTC
TATATAAATTTATCTATGAAACCGAGATAGTTCCCTTTCAGAAAATTCTAACACTAGTAGAAATGCCTATGCTTTATTCTTCTGAAGGTGGGAAAAAAGA
TAAAACTAAATAAACGGATTATTCATCCAAATTTCAGTTTGAAACTCATGTAATTAACCTATTTTTCTTTTGGTTAACCCTAAAACTGGGATAGATCCAT
GAGAAATCTGATTATATTTTATTAGATATGGTATAGATCAAAATGGGACACCAAAAGAATTGACTGCTGAGCCGTATGAGGT

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.95202
Expected error %
0.727793
Sequence Annotations 
Automatic Annotations
Nicotiana tabacum Chloroplast (screening/organelle/nicotiana_tabacum_chloroplast)NCBI BLAST
gi|11465934|ref|NC_001879.1| Score 795 E Value 0 Identity 96.70% Align. Length 781bp (99.87%) Frame 2
Nicotiana tabacum plastid, complete genome
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0074L22
Clone
Clone name
hba-74l22
LE_HBa0074L22
P074L22
Clone type
BAC
Contamination
none
Estimated length
66,463
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found