Clone Read LE_HBa0074N04_SP6_55542

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0074N04_SP6_55542
Primer
SP6
ID from Seq. Facility
LE_HBa_074_N04-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
745 trimmed for vector and quality, 835 raw
Genbank Accession
Sequence
>LE_HBa0074N04_SP6_55542 (raw untrimmed)
GGACCGAGAATCTTTCATCTCTCCAGCTGTATCATGTTCTTCCAAAACTTCTGAACATGAAACATGTCACAGTATCCCCTCTTTTGAGATGAGAGATGAT
CTACTGAATGAACTATTTGACCACCAGTGCAGCGAGCTATACGCTCCAAGACTGGTTTTTTGATGTTTAAGACAAGTGATATATCTTTTTCCAAGAGGTA
CTCCTGTGCATAGCGAGAAACAGATTTTTCCACCAGAAGAACATCCGGATTGTGTGCATCAATTCTGGCAACAGCCATCTTCAGATGATCCATTTCCTGA
ATAGCAAAAAATATTTTTAAGCACAAGAGCACTACATTATCAGTTAAAAGTCTTTGAAGAAAAGGTAAAATAATCAAAACCTGCTGCAACAATGTAGCGA
AACTTGATAAGTGGTTAGAGACGCGCTGGTACTCGAGAGCACCTTCAAGGATTACTATGCGGGCTTTCTCAACTTTTGATGTCATTCGCCGATGAGCTAC
ATTTTTCTTGCAGACAACTCCTTTCACCACAGCACTATTTAATGGAACGAGTTCAAATAAGAGAAGATATGACAAAATGTACACAATAACAAAAGGAGCT
GAAGAAGTGCAGATAAAAACACAGGAAGAAGAAGCAAGAACAGAATCACAAGAAATAAAAGCTGCCCAATTATGCCACACCCTATTTATAGCTAGCCCAA
TAAGACAAGTTAATCTAGGGAAAAGCAACCCCGACTCTAAACACCTCTTTACTCATCGAAATGCTACAACTTCACCAAATATTACTCGAGGGCAAAGAAT
TGAAAGTTTTAAGGGAGGAACACAAGCTATCTCAC
>LE_HBa0074N04_SP6_55542 (trimmed for quality and cloning vector)
GCTGTATCATGTTCTTCCAAAACTTCTGAACATGAAACATGTCACAGTATCCCCTCTTTTGAGATGAGAGATGATCTACTGAATGAACTATTTGACCACC
AGTGCAGCGAGCTATACGCTCCAAGACTGGTTTTTTGATGTTTAAGACAAGTGATATATCTTTTTCCAAGAGGTACTCCTGTGCATAGCGAGAAACAGAT
TTTTCCACCAGAAGAACATCCGGATTGTGTGCATCAATTCTGGCAACAGCCATCTTCAGATGATCCATTTCCTGAATAGCAAAAAATATTTTTAAGCACA
AGAGCACTACATTATCAGTTAAAAGTCTTTGAAGAAAAGGTAAAATAATCAAAACCTGCTGCAACAATGTAGCGAAACTTGATAAGTGGTTAGAGACGCG
CTGGTACTCGAGAGCACCTTCAAGGATTACTATGCGGGCTTTCTCAACTTTTGATGTCATTCGCCGATGAGCTACATTTTTCTTGCAGACAACTCCTTTC
ACCACAGCACTATTTAATGGAACGAGTTCAAATAAGAGAAGATATGACAAAATGTACACAATAACAAAAGGAGCTGAAGAAGTGCAGATAAAAACACAGG
AAGAAGAAGCAAGAACAGAATCACAAGAAATAAAAGCTGCCCAATTATGCCACACCCTATTTATAGCTAGCCCAATAAGACAAGTTAATCTAGGGAAAAG
CAACCCCGACTCTAAACACCTCTTTACTCATCGAAATGCTACAAC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.963189
Expected error %
0.144045
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g33240.1 Score 207 E Value 6e-54 Identity 22.20% Align. Length 491bp (65.91%) Frame 3
68417.m04731 phosphatidylinositol-4-phosphate 5-kinase family protein similar to SP|Q9Z1T6 FYVE finger-containing phosphoinositide kinase (EC 2.7.1.68) (1- phosphatidylinositol-4-phosphate kinase) (PIP5K) (PtdIns(4)P-5-kinase) {Mus musculus}; contains Pfam profiles PF01504: Phosphatidylinositol-4-phosphate 5-Kinase, PF01363: FYVE zinc finger, PF00118: TCP-1/cpn60 chaperonin family
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g14270.1 Score 190 E Value 6e-49 Identity 20.60% Align. Length 494bp (66.31%) Frame 3
68416.m01806 phosphatidylinositol-4-phosphate 5-kinase family protein similar to SP|Q9Z1T6 FYVE finger-containing phosphoinositide kinase (EC 2.7.1.68) (1- phosphatidylinositol-4-phosphate kinase) (PIP5K) (PtdIns(4)P-5-kinase) {Mus musculus}; contains Pfam profiles PF01504: Phosphatidylinositol-4-phosphate 5-Kinase, PF01363: FYVE zinc finger, PF00118: TCP-1/cpn60 chaperonin family
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_195050.2| Score 207 E Value 3e-52 Identity 22.20% Align. Length 491bp (65.91%) Frame 3
phosphatidylinositol-4-phosphate 5-kinase family protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB80041.1| Score 207 E Value 3e-52 Identity 22.20% Align. Length 491bp (65.91%) Frame 3
putative protein [Arabidopsis thaliana] emb|CAB36798.1| putative protein [Arabidopsis thaliana] pir||T05204 hypothetical protein F4I10.170 - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0074N04
Clone
Clone name
hba-74n4
LE_HBa0074N04
P074N04
Clone type
BAC
Contamination
none
Estimated length
88,523
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found