Clone Read LE_HBa0074N04_T7_55543

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0074N04_T7_55543
Primer
T7
ID from Seq. Facility
LE_HBa_074_N04-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
640 trimmed for vector and quality, 865 raw
Genbank Accession
Sequence
>LE_HBa0074N04_T7_55543 (raw untrimmed)
ACTAAACCTGGCCCCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTAACATAACTATAATATAGAGTATATTTTTTTTTTTCAAAAAAAT
AAATAGTTGAATTAGTACCTGGTGACTCCGCGGTACTGCGAAGTTCTTTGCCCAAAAGTATCAATGGATTTGCGCGGAACTGATTCCTTTGAACCACCAC
CATTTTTAACTGCTACCGGCCGTTTTTTGGGAGCGGCTGCAAGCGAGAGCGCCTGGCAATTGCTAGGATTTACAATTTCTTCAGCTGACGACATTAATGG
TGCAGCAACAGAAGCCTGGCGTAACCACGATTTGAATCCAGAAACAGAAGTAGCTCCGTCAAATGGCAGATGATAGACACTACTAGTAGAGTGTGCAAAC
TCATGATGAGAGCTCTGCAATTGACTATTTTGAATCATCATCTGTGGAGACTGGATCAATTTCATGTTTGCTCCAATTTCTAACTGGTGTTGTTCGTGAT
CAGATTGATTTATGCTTGGTGGAATATTAACGTTGATTTCAGAAATTTGTTGTTCTTCATTAGAAGGAGAATTTGAGTAACAGCATCCAAGGAAATCCTC
AAGCTTCGGACCCTCTTCTTCTTCTGGATTATTAGCAGTACTCATTTTCATGATTCTCATACCTCCAACAATCAATTTTTGAAAAACAAGAATAAAATTA
CCAGTATCAACTTCTCTTTTAACACATGAGTTAGCAGTGGAAAAACGGACCAAATCACTAAAAATACCTTCGTTGGGTTCACAGCGGGGGAAAGGATCCA
TCATACATAGAGAACCATTAATGCTTAAAGGGATGACCGAACCAGGAGTATTTTCCGCCACCTCC
>LE_HBa0074N04_T7_55543 (trimmed for quality and cloning vector)
CTAGAGTCGACCTGCAGGCATGCAAGCTTTTAACATAACTATAATATAGAGTATATTTTTTTTTTTCAAAAAAATAAATAGTTGAATTAGTACCTGGTGA
CTCCGCGGTACTGCGAAGTTCTTTGCCCAAAAGTATCAATGGATTTGCGCGGAACTGATTCCTTTGAACCACCACCATTTTTAACTGCTACCGGCCGTTT
TTTGGGAGCGGCTGCAAGCGAGAGCGCCTGGCAATTGCTAGGATTTACAATTTCTTCAGCTGACGACATTAATGGTGCAGCAACAGAAGCCTGGCGTAAC
CACGATTTGAATCCAGAAACAGAAGTAGCTCCGTCAAATGGCAGATGATAGACACTACTAGTAGAGTGTGCAAACTCATGATGAGAGCTCTGCAATTGAC
TATTTTGAATCATCATCTGTGGAGACTGGATCAATTTCATGTTTGCTCCAATTTCTAACTGGTGTTGTTCGTGATCAGATTGATTTATGCTTGGTGGAAT
ATTAACGTTGATTTCAGAAATTTGTTGTTCTTCATTAGAAGGAGAATTTGAGTAACAGCATCCAAGGAAATCCTCAAGCTTCGGACCCTCTTCTTCTTCT
GGATTATTAGCAGTACTCATTTTCATGATTCTCATACCTC

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.972541
Expected error %
0.300622
Sequence Annotations 
Automatic Annotations
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|U02430.1:1751-1832 Score 62 E Value 7e-11 Identity 100.00% Align. Length 30bp (4.69%) Frame 2
Cloning vector pMAMneoBlue
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|U02437.1:4662-4674-49 Score 62 E Value 7e-11 Identity 100.00% Align. Length 30bp (4.69%) Frame 2
Cloning vector pT3/T7-LUC
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0074N04
Clone
Clone name
hba-74n4
LE_HBa0074N04
P074N04
Clone type
BAC
Contamination
none
Estimated length
88,523
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found