Clone Read LE_HBa0011I19_T7_5586

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0011I19_T7_5586
Primer
T7
ID from Seq. Facility
LE_HBa_011_I19-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
875 trimmed for vector and quality, 967 raw
Genbank Accession
Sequence
>LE_HBa0011I19_T7_5586 (raw untrimmed)
CGTAAATCTGGTACCGGGGGTACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTAGAACAAATACATGGTTGGACTTTGTCAGTACGCACATGAACAA
ACTCACTCTAGAAAGAAAGCACCTCTTCGAGCCAGTCATTTTTGGATGACCATGCAGCATGATTGTGCAAGTTTGTGCAGAAATTTCATAAATGTCAAGT
GCATGGAGATTTAATTTGTGTGCTGCCTTACGAACTCAATGTATGAGTTCTCCTTGGCCCTTTGTAGCTTGGGGCATAGATGTCATTTGTTCAATAGAGC
CAGCCACCTCTAATGGACACAGATTAATTTTAGTTATCATTGACTATTTCAACAAGTGGGTGGAAGAATCTTCGTACAAGTCAGTGACCAAGAAAGTTAT
TACAGATTTTATTCCAACAATATGATATGAAGGTTTGGAGTACCAGAATCCATCATTACTGATAATGGTGCAAATATCAATAGTCACTTAATGAGAGATA
TATGTGAAAAATTTCATATTACTCATCAAAACTCAACCGCTTATCGCCCTCAAATGAATGGAATCATGGAGGCATTCAACAAGAACATCAAGAAGATTAT
GAGAAAAATAATTGACAATCACCGAGGTTGGCATGAGATGTTGGCATAATCTTTTTTGGGATACCGAACGAGTGTCAGAATGTCGATTGAGGGCTCCCCA
TACTTGTTAGTGTACGGAACACAAGTAGTCACACCTGCTAAAGTGGATACCATCTTTCAGAATCATTCAAGAAGCTGAGTTAAGTAATGTGAATAGGTAC
TTAAGTGGATTGATCAGTTAACCTTTATTGATGAGAAGAGAATGGTTGTCGCTTTTCATGGACAACTATATCGACAGAGAATAATTCTTTCTTTTCACAA
GAGAATCAGAGCAAGAATTTTTTTAAAGCGGCCAATTGGTCGTTAAGCGCATTATCCTCTTCAAGAG
>LE_HBa0011I19_T7_5586 (trimmed for quality and cloning vector)
AGCTTCTAGAACAAATACATGGTTGGACTTTGTCAGTACGCACATGAACAAACTCACTCTAGAAAGAAAGCACCTCTTCGAGCCAGTCATTTTTGGATGA
CCATGCAGCATGATTGTGCAAGTTTGTGCAGAAATTTCATAAATGTCAAGTGCATGGAGATTTAATTTGTGTGCTGCCTTACGAACTCAATGTATGAGTT
CTCCTTGGCCCTTTGTAGCTTGGGGCATAGATGTCATTTGTTCAATAGAGCCAGCCACCTCTAATGGACACAGATTAATTTTAGTTATCATTGACTATTT
CAACAAGTGGGTGGAAGAATCTTCGTACAAGTCAGTGACCAAGAAAGTTATTACAGATTTTATTCCAACAATATGATATGAAGGTTTGGAGTACCAGAAT
CCATCATTACTGATAATGGTGCAAATATCAATAGTCACTTAATGAGAGATATATGTGAAAAATTTCATATTACTCATCAAAACTCAACCGCTTATCGCCC
TCAAATGAATGGAATCATGGAGGCATTCAACAAGAACATCAAGAAGATTATGAGAAAAATAATTGACAATCACCGAGGTTGGCATGAGATGTTGGCATAA
TCTTTTTTGGGATACCGAACGAGTGTCAGAATGTCGATTGAGGGCTCCCCATACTTGTTAGTGTACGGAACACAAGTAGTCACACCTGCTAAAGTGGATA
CCATCTTTCAGAATCATTCAAGAAGCTGAGTTAAGTAATGTGAATAGGTACTTAAGTGGATTGATCAGTTAACCTTTATTGATGAGAAGAGAATGGTTGT
CGCTTTTCATGGACAACTATATCGACAGAGAATAATTCTTTCTTTTCACAAGAGAATCAGAGCAAGAATTTTTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.955431
Expected error %
1.37483
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89777.1| Score 143 E Value 7e-33 Identity 60.20% Align. Length 361bp (41.26%) Frame 3
gag-pol polyprotein-like [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAQ82037.1| Score 143 E Value 7e-33 Identity 36.50% Align. Length 830bp (94.86%) Frame 2
gag/pol polyprotein [Pisum sativum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0011I19
Clone
Clone name
hba-11i19
LE_HBa0011I19
C08HBa0011I19
P011I19
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found