Clone Read LE_HBa0088L02_SP6_56210

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0088L02_SP6_56210
Primer
SP6
ID from Seq. Facility
LE_HBa_088_L02-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
683 trimmed for vector and quality, 833 raw
Sequence
>LE_HBa0088L02_SP6_56210 (raw untrimmed)
GGGGGCCAGGTTTGGAGTGGATTATTAGACTGCCCACATGTTTGCAATCCAACCTACCAGCATCTTTCAAAATGTGTAAGACATATTTCCTTTAAGAAAT
AGCAATACCATGGACGAATTGTGCCACTTCAATGCCCAGAAAGTATTTCAACTTGCCCAAATCCTTGGTATGAAAGTGAGTTGAGAAGTGTTGTTTGAGT
TGAACAATACCTCCTAATCATCTCCTGTAATAACAATATCATCAACACAAACAATTAAAAGATATGTTTGTCATTAGATGAATGCCTATAGTATAAGAGT
GATTCTCTTATGTTCGAATCATTCCAAATTGTTGGAAAATAGCTCGAAATCAACCAAACCATGCTCTGGGAGGCTGCTTGAGACCATAAAGGGATCGACG
AAGTTTACAAACTAGTCTAGACTCCCCCTGATATCTACCTCTTTAGCAAATGGGCCAATGATTCATTGTTTCCATAGAGATGAGAAGACGAACAAAAGTC
ATCTTGGCAACTGGTGAGAAAGTATCTCCATAATCGATGCCATAAATCTGAGTGTGTCCCTTAGTAACCAGTCTTGCTTTGAGACGATCAATAGCTCCAT
CCGAACCTACCTTAACTATGAATATCCAACGACAACTAATTGTGATTTTGCCTTCAGGTAAAGGAACAAGCTCCCAAGTACCATTATCATGCAAAACAAT
CATCTCTTCAATCATAGCTTGACGTCAACCTGGATGAACCAATGGCTCTCACAGTCTAAAAACTTTAACCGATGATAAGCTAATAAAGAAGGCATGATAT
GAAGGTGACAAACAATGAAACTTAAATAAAAAT
>LE_HBa0088L02_SP6_56210 (trimmed for quality and cloning vector)
TTAGACTGCCCACATGTTTGCAATCCAACCTACCAGCATCTTTCAAAATGTGTAAGACATATTTCCTTTAAGAAATAGCAATACCATGGACGAATTGTGC
CACTTCAATGCCCAGAAAGTATTTCAACTTGCCCAAATCCTTGGTATGAAAGTGAGTTGAGAAGTGTTGTTTGAGTTGAACAATACCTCCTAATCATCTC
CTGTAATAACAATATCATCAACACAAACAATTAAAAGATATGTTTGTCATTAGATGAATGCCTATAGTATAAGAGTGATTCTCTTATGTTCGAATCATTC
CAAATTGTTGGAAAATAGCTCGAAATCAACCAAACCATGCTCTGGGAGGCTGCTTGAGACCATAAAGGGATCGACGAAGTTTACAAACTAGTCTAGACTC
CCCCTGATATCTACCTCTTTAGCAAATGGGCCAATGATTCATTGTTTCCATAGAGATGAGAAGACGAACAAAAGTCATCTTGGCAACTGGTGAGAAAGTA
TCTCCATAATCGATGCCATAAATCTGAGTGTGTCCCTTAGTAACCAGTCTTGCTTTGAGACGATCAATAGCTCCATCCGAACCTACCTTAACTATGAATA
TCCAACGACAACTAATTGTGATTTTGCCTTCAGGTAAAGGAACAAGCTCCCAAGTACCATTATCATGCAAAACAATCATCTCT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.961216
Expected error %
0.25651
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23160.1 Score 140 E Value 5e-34 Identity 12.60% Align. Length 665bp (97.36%) Frame 3
68417.m03342 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT40550.1| Score 223 E Value 4e-57 Identity 18.20% Align. Length 671bp (98.24%) Frame 3
putative receptor kinase [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38747.1| Score 192 E Value 8e-48 Identity 15.80% Align. Length 665bp (97.36%) Frame 3
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0088L02
Clone
Clone name
hba-88l2
LE_HBa0088L02
C01HBa0088L02
P088L02
Clone type
BAC
Contamination
none
Estimated length
97,347
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found