Clone Read LE_HBa0088L02_T7_56211

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0088L02_T7_56211
Primer
T7
ID from Seq. Facility
LE_HBa_088_L02-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
711 trimmed for vector and quality, 852 raw
Sequence
>LE_HBa0088L02_T7_56211 (raw untrimmed)
AACAAACCTGGTCCGGGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTCTCAATGTCCAGTTTGCATAGGATGCCTGGTTTTCTTTTGACCCAC
TCAGAGTCTGTTGCTTCATTTGCTATTAACACCGCATCCATGATTTGCCTTCCTTCGATAAAAGCCATCTGTTGGGAGTCTACCAGCTTGTACATCACCC
TTTTGATTCTTTCTGTTAAAACTTTAGACTAAAATTTATAGAAACTGCGTATCAAGCTTATTAGTTTGAACTCTTCAAGTTCCTTTGCTCCTTTCTTCTT
TGGGATTAAGGCAATATAGGTAGCATTGACACTCTTCTCAAACATTTCCTGCTCATAGAAATTATGGAATGCTGCCATGATGTCATGCTAAAGAGTTTCC
CAACATTTGATGAAAAAACCCATTGTGTAACCATCAGGTCCTGGGGCTTTGTCAATGGCACATAACTTCAAGCATTTAATAACTTCCTGCTCCTCAAACT
TTGCCTGTAGTTGTGATCTTTCTTCCTCTTATATTGAAGGACAATTCACTAAATTTCCATCAGGTCTCCATTTTTCTGTTTCAAAATACAGTTTCTCATA
AAACTTAATGATTTCCTCCCTTACTCTGTCTCGTTCTGTGATGATCTTTCCCTCTACTTCCAACTGGTCAATATGGTTGCTTCTTTTGGGGGCATTTGCA
TTGTGGAAGAATTTTATATTCCTGCCTCCTTCCTTCAACCACTAAATTCTAACCTTTGTCTCCAAAACCATCCTCATTTTTTAACAGTTCTTCGTACCCC
CAAAGATCTCTCCCTTCAAAAGTAGCCTCCTCCCTCTCCCACGCCCTTTGGT
>LE_HBa0088L02_T7_56211 (trimmed for quality and cloning vector)
AGCTTTCTCAATGTCCAGTTTGCATAGGATGCCTGGTTTTCTTTTGACCCACTCAGAGTCTGTTGCTTCATTTGCTATTAACACCGCATCCATGATTTGC
CTTCCTTCGATAAAAGCCATCTGTTGGGAGTCTACCAGCTTGTACATCACCCTTTTGATTCTTTCTGTTAAAACTTTAGACTAAAATTTATAGAAACTGC
GTATCAAGCTTATTAGTTTGAACTCTTCAAGTTCCTTTGCTCCTTTCTTCTTTGGGATTAAGGCAATATAGGTAGCATTGACACTCTTCTCAAACATTTC
CTGCTCATAGAAATTATGGAATGCTGCCATGATGTCATGCTAAAGAGTTTCCCAACATTTGATGAAAAAACCCATTGTGTAACCATCAGGTCCTGGGGCT
TTGTCAATGGCACATAACTTCAAGCATTTAATAACTTCCTGCTCCTCAAACTTTGCCTGTAGTTGTGATCTTTCTTCCTCTTATATTGAAGGACAATTCA
CTAAATTTCCATCAGGTCTCCATTTTTCTGTTTCAAAATACAGTTTCTCATAAAACTTAATGATTTCCTCCCTTACTCTGTCTCGTTCTGTGATGATCTT
TCCCTCTACTTCCAACTGGTCAATATGGTTGCTTCTTTTGGGGGCATTTGCATTGTGGAAGAATTTTATATTCCTGCCTCCTTCCTTCAACCACTAAATT
CTAACCTTTGT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.945266
Expected error %
0.925794
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g43760.1 Score 70 E Value 9e-13 Identity 10.50% Align. Length 521bp (73.28%) Frame 2
68414.m05034 hypothetical protein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA73798.1| Score 157 E Value 3e-37 Identity 11.80% Align. Length 692bp (97.33%) Frame 2
reverse transcriptase [Beta vulgaris subsp. vulgaris] pir||T14619 reverse transcriptase - beet retrotransposon (fragment)
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAX95804.1| Score 130 E Value 4e-29 Identity 11.80% Align. Length 692bp (97.33%) Frame 2
retrotransposon protein, putative, unclassified [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0088L02
Clone
Clone name
hba-88l2
LE_HBa0088L02
C01HBa0088L02
P088L02
Clone type
BAC
Contamination
none
Estimated length
97,347
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found