Clone Read LE_HBa0101C24_SP6_56590

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0101C24_SP6_56590
Primer
SP6
ID from Seq. Facility
LE_HBa_101_C24-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
622 trimmed for vector and quality, 764 raw
Genbank Accession
Sequence
>LE_HBa0101C24_SP6_56590 (raw untrimmed)
AAAAGGTGGGATTTTGGGTACAAAATCTAAAATCCAACAATAAATTGCAGGGATCAGTGAAGAGGAAGCTTTAACAAGTGGTACTTGGATAATGCATGCT
CAAGACATAGGACTGGAGATAAAAGAAGCTTCCTCTCACTCAAGAACATCAAAGGAGGAAATGTTGCCTTTGGAAATGGTAAAAATGGAGAAATTCAAGG
AATTGGAAAGGTTGGAACAATGGATACTTATGCAATTGAGAATGTATATTATGTAAATGGTCTACAACATAATCTTTTGAGCGTATCGCAAATATGTGAC
AAAGGAAACAACGTTCTCTTTATAGAAAAAGAATGTAGAGTAACAAACTCAGTGACTGGAAATCTGGTTCTACTAGGAAAGAGACACAAGAATGTGTACA
AAGTCAAGACTGGTGACTCCAAGGAAGATAATCTTAAATGTCTGAGTGCAGTCTCAGATTGCTCCATGCTATGACACAAAAGAATGGGACACATTAGCAT
GACAACTATAAACAAACTCATATCTAAAGACCCGGTTAAGGGACTGCCAACCAAAAGTTTCAAGGACAACCAAGTATGTGGAACCTGTATTCAAGGAAAA
CAGGTTAGGTCATCCTTCAAACCAAAGTTGACAGTAAGTACTACTAAGCCACTGGAATTGCTTCACATGGATTTGTCTAGACCAATGCGTGTACAAAGCA
GGGGTGGAAAAAGAATTGTGTTTGTAATAATTGATTAACTCTCAAGATTTCTTTGGACATTGTT
>LE_HBa0101C24_SP6_56590 (trimmed for quality and cloning vector)
AAAATCTAAAATCCAACAATAAATTGCAGGGATCAGTGAAGAGGAAGCTTTAACAAGTGGTACTTGGATAATGCATGCTCAAGACATAGGACTGGAGATA
AAAGAAGCTTCCTCTCACTCAAGAACATCAAAGGAGGAAATGTTGCCTTTGGAAATGGTAAAAATGGAGAAATTCAAGGAATTGGAAAGGTTGGAACAAT
GGATACTTATGCAATTGAGAATGTATATTATGTAAATGGTCTACAACATAATCTTTTGAGCGTATCGCAAATATGTGACAAAGGAAACAACGTTCTCTTT
ATAGAAAAAGAATGTAGAGTAACAAACTCAGTGACTGGAAATCTGGTTCTACTAGGAAAGAGACACAAGAATGTGTACAAAGTCAAGACTGGTGACTCCA
AGGAAGATAATCTTAAATGTCTGAGTGCAGTCTCAGATTGCTCCATGCTATGACACAAAAGAATGGGACACATTAGCATGACAACTATAAACAAACTCAT
ATCTAAAGACCCGGTTAAGGGACTGCCAACCAAAAGTTTCAAGGACAACCAAGTATGTGGAACCTGTATTCAAGGAAAACAGGTTAGGTCATCCTTCAAA
CCAAAGTTGACAGTAAGTACTA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.945183
Expected error %
0.384577
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAO73521.1| Score 129 E Value 4e-29 Identity 12.50% Align. Length 536bp (86.17%) Frame 2
gag-pol polyprotein [Glycine max]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAO73527.1| Score 129 E Value 4e-29 Identity 12.50% Align. Length 536bp (86.17%) Frame 2
gag-pol polyprotein [Glycine max]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0101C24
Clone
Clone name
hba-101c24
LE_HBa0101C24
C03HBa0101C24
P101C24
Clone type
BAC
Contamination
none
Estimated length
111,763
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found