Clone Read LE_HBa0101C24_T7_56591

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0101C24_T7_56591
Primer
T7
ID from Seq. Facility
LE_HBa_101_C24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
608 trimmed for vector and quality, 755 raw
Genbank Accession
Sequence
>LE_HBa0101C24_T7_56591 (raw untrimmed)
CTCTCGTACACGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAATTTTCTTGCTAATACAACCCCTTGAAGAGCATACAGTGTCCAGCATCTT
AGTCAATAGATCCCTTCTACTAGAGAACCTCATCTAAAGGCAGCTTATCATGTACTCAGGTATCTACAAAATGATCCTACTTTGGAAATTTTTATCAATA
ATAAACCTGATGTCACTATTAGTGCCTATTGTGACTCAGATTGGGCTTCTTGTCCTGATTCAAGGAAGTCTGTGAGTGGTTATTTGGTTCTCATGGGAGA
TAGTCCTATCAGCTGGAAATCTAAGAAGCAACTCACAGTGTCACTTTCATCAGCAGAAGCTGAATACAGAGCCATAAGACAGGTGGTAGGAGAAGTAGTG
TGGCTGGAAAGGTTACTTGGTGAACTCTCAATGACAGTGTCCTTACCAATACATGTATTTTGTGACAGCCAAGCAGCAGTACACATTGCTAGGAATCCAA
TATTTCATGAACGAACTAAACACATAGAAGTTGATTGCCATTTCGTCAGGACAAAGCTACAAGAAGGACTGATCACACTCCAATACATTCCACCATATTC
TCAGCTAGCTGATGTCTTCTCCAAGGCTTTAACTGGGGTCAACTTACTATTTTACTGCCCACTTTTTTTGTATTATTTTTTTCCCCCTACTTTAGGAAGG
GGTGATAAACCATACCCAGTTATTTAAAAGCCTAAATTAGAGATTTAGTACCCAA
>LE_HBa0101C24_T7_56591 (trimmed for quality and cloning vector)
AGCTTAATTTTCTTGCTAATACAACCCCTTGAAGAGCATACAGTGTCCAGCATCTTAGTCAATAGATCCCTTCTACTAGAGAACCTCATCTAAAGGCAGC
TTATCATGTACTCAGGTATCTACAAAATGATCCTACTTTGGAAATTTTTATCAATAATAAACCTGATGTCACTATTAGTGCCTATTGTGACTCAGATTGG
GCTTCTTGTCCTGATTCAAGGAAGTCTGTGAGTGGTTATTTGGTTCTCATGGGAGATAGTCCTATCAGCTGGAAATCTAAGAAGCAACTCACAGTGTCAC
TTTCATCAGCAGAAGCTGAATACAGAGCCATAAGACAGGTGGTAGGAGAAGTAGTGTGGCTGGAAAGGTTACTTGGTGAACTCTCAATGACAGTGTCCTT
ACCAATACATGTATTTTGTGACAGCCAAGCAGCAGTACACATTGCTAGGAATCCAATATTTCATGAACGAACTAAACACATAGAAGTTGATTGCCATTTC
GTCAGGACAAAGCTACAAGAAGGACTGATCACACTCCAATACATTCCACCATATTCTCAGCTAGCTGATGTCTTCTCCAAGGCTTTAACTGGGGTCAACT
TACTATTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.960734
Expected error %
1.55328
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23160.1 Score 144 E Value 3e-35 Identity 14.50% Align. Length 476bp (78.29%) Frame 1
68417.m03342 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAD19784.1| Score 220 E Value 2e-56 Identity 18.30% Align. Length 584bp (96.05%) Frame 1
putative retroelement pol polyprotein [Arabidopsis thaliana] pir||C84512 probable retroelement pol polyprotein [imported] - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89730.1| Score 213 E Value 2e-54 Identity 17.30% Align. Length 590bp (97.04%) Frame 1
putative polyprotein [Solanum tuberosum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0101C24
Clone
Clone name
hba-101c24
LE_HBa0101C24
C03HBa0101C24
P101C24
Clone type
BAC
Contamination
none
Estimated length
111,763
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found