Clone Read LE_HBa0101E05_T7_56649

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0101E05_T7_56649
Primer
T7
ID from Seq. Facility
LE_HBa_101_E05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
723 trimmed for vector and quality, 792 raw
Genbank Accession
Sequence
>LE_HBa0101E05_T7_56649 (raw untrimmed)
CTGCGGTACCCGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATTCTATAAATCTTTTAGGAGTAAAACTTAAAAAGGTATCTTGTGTAGCAC
TTTTTTTTGTTAAATAACTTTAGATTAAGAATACTTGGCTTAATAGTTCCAACATACATGTTAGCTTAATTCATATTTTCACGTTTGAACACATGTTCAA
AGAGTATCAAGTGGCTTCAGCATTTTACATTACTGGTAGCATCTTATCCTACTGAAAGTTATCCTTGCCTTTTAGTGGCCGCTAATTATTGTTATCCCTT
TGTCTAATCTTTCCTAGAAATCGTCTAAAAAGGCTAACCAATCATCCAAGGAAGCACACAATACCAAGGGCAAGGTACTTTGACTCTTAACTTGTCACCT
TTTTATTTGTTTTGGATTATGGTTACCAAAATGTGATCTTTTTAACTTTCCCTCTTTTAGTCAACTAAGTTCCGGTAGAATACTCTGCTTTGAAGAGTTC
AGAAAATGCATTTTAGCCTTCATTTGTAATTTTCAAGAGACAAAGTAGCTTAGAGTGTCAAGTTGATCATGAAATTACACTCTGTTATGTTGCTTTCACT
ATTATGCACATGTTGTATATCTTTTCGTAGTTATATTTGCCTTCTAGGGGATCCAATCACAGTTTCTTTGTTTTCAATCCTTCTCAGGAATCATTTCTGA
AGGTTTACCCTTCGACGCCTATTCACTGTCTTGAGCTTTGGACTGCAGCTAACTGTGCATACAGTTCAAAACCTGATTTTTATTCCCCTTGT
>LE_HBa0101E05_T7_56649 (trimmed for quality and cloning vector)
AGCTTATTCTATAAATCTTTTAGGAGTAAAACTTAAAAAGGTATCTTGTGTAGCACTTTTTTTTGTTAAATAACTTTAGATTAAGAATACTTGGCTTAAT
AGTTCCAACATACATGTTAGCTTAATTCATATTTTCACGTTTGAACACATGTTCAAAGAGTATCAAGTGGCTTCAGCATTTTACATTACTGGTAGCATCT
TATCCTACTGAAAGTTATCCTTGCCTTTTAGTGGCCGCTAATTATTGTTATCCCTTTGTCTAATCTTTCCTAGAAATCGTCTAAAAAGGCTAACCAATCA
TCCAAGGAAGCACACAATACCAAGGGCAAGGTACTTTGACTCTTAACTTGTCACCTTTTTATTTGTTTTGGATTATGGTTACCAAAATGTGATCTTTTTA
ACTTTCCCTCTTTTAGTCAACTAAGTTCCGGTAGAATACTCTGCTTTGAAGAGTTCAGAAAATGCATTTTAGCCTTCATTTGTAATTTTCAAGAGACAAA
GTAGCTTAGAGTGTCAAGTTGATCATGAAATTACACTCTGTTATGTTGCTTTCACTATTATGCACATGTTGTATATCTTTTCGTAGTTATATTTGCCTTC
TAGGGGATCCAATCACAGTTTCTTTGTTTTCAATCCTTCTCAGGAATCATTTCTGAAGGTTTACCCTTCGACGCCTATTCACTGTCTTGAGCTTTGGACT
GCAGCTAACTGTGCATACAGTTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.944808
Expected error %
1.14373
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0101E05
Clone
Clone name
hba-101e5
LE_HBa0101E05
C02HBa0101E05
P101E05
Clone type
BAC
Contamination
none
Estimated length
83,229
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found