Clone Read LE_HBa0011M04_T7_5667

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0011M04_T7_5667
Primer
T7
ID from Seq. Facility
LE_HBa_011_M04-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
703 trimmed for vector and quality, 942 raw
Genbank Accession
Sequence
>LE_HBa0011M04_T7_5667 (raw untrimmed)
CCGAGCTCGGGACCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTGTTATGTATAGCTGAAGTCCCTTTTAATCTATGAACAGTTAGGAT
GGATGAAGTTGGTTACCTTCTCCATGAGGCAAGGAAAATGATCGTTGTTTGGCAAGAAATAGAAACCGATTGTTGCCTGTTTTAGATACAAGAGATTTAC
CTCATGCCCCGAGTTCTTCAAACCATCGACATATGCCAATTGCCAATCCTGACTAAGATCCAAACCAGCCACCACTACTAGACTCTTTGGAAACTTTAGT
CCTTTGAGGCTTCTACTCCTCGAGCCAAATATGTTACATGCCGGATGATCTCTATCTTCCCCTTCCGGTAGATAGGCCCTCCAGTACCAATCTCTGTCTT
GTACGGTAACAAAGTATTTCCCGTCTAATCTCTTCTCAGATTCTGTCCTGTTTTGCCCACCAAACATTGGATGAAGATGTATATTACCTAATACTTCGAC
ACCTGCTTCAGCAGCCCTTACAGCAACGTGGTGAGCAATATTACCACCTGAACTATCGCCAGCCATATAGACGTGGACTTTCGAGTCCTTCCCACTTTGA
AGCCATGTCCTTGATTTTACCCATTTTAGAGCAGCCCATCCGTCATCGTATGCACAAGGATATCGATGTTCTGGAGATCGTCTATAGTTCACAGAAACAA
CAACAGCCTTGCAAATCTTAACTAGGCGGCGACCAAATGTATCATAAATAGCACTATTGGCTGAGGAATGAGTATAATTTCCCCGTGGAATTAATTAAAA
CAGGACAATTTCCGGGTGCTCCGAGTTTTCTCGAGCTTTTTTTACCCAATCACCCCATTTTCAGGACAGGTCAATATTTTCAATAAAAAACTCTTACACG
ATAAAAATTCATAAAAAATAAACATTCAATGGATTTATTTGT
>LE_HBa0011M04_T7_5667 (trimmed for quality and cloning vector)
AGCTTTTGTTATGTATAGCTGAAGTCCCTTTTAATCTATGAACAGTTAGGATGGATGAAGTTGGTTACCTTCTCCATGAGGCAAGGAAAATGATCGTTGT
TTGGCAAGAAATAGAAACCGATTGTTGCCTGTTTTAGATACAAGAGATTTACCTCATGCCCCGAGTTCTTCAAACCATCGACATATGCCAATTGCCAATC
CTGACTAAGATCCAAACCAGCCACCACTACTAGACTCTTTGGAAACTTTAGTCCTTTGAGGCTTCTACTCCTCGAGCCAAATATGTTACATGCCGGATGA
TCTCTATCTTCCCCTTCCGGTAGATAGGCCCTCCAGTACCAATCTCTGTCTTGTACGGTAACAAAGTATTTCCCGTCTAATCTCTTCTCAGATTCTGTCC
TGTTTTGCCCACCAAACATTGGATGAAGATGTATATTACCTAATACTTCGACACCTGCTTCAGCAGCCCTTACAGCAACGTGGTGAGCAATATTACCACC
TGAACTATCGCCAGCCATATAGACGTGGACTTTCGAGTCCTTCCCACTTTGAAGCCATGTCCTTGATTTTACCCATTTTAGAGCAGCCCATCCGTCATCG
TATGCACAAGGATATCGATGTTCTGGAGATCGTCTATAGTTCACAGAAACAACAACAGCCTTGCAAATCTTAACTAGGCGGCGACCAAATGTATCATAAA
TAG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.981464
Expected error %
0.515775
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g63010.1 Score 361 E Value 1e-100 Identity 26.30% Align. Length 650bp (92.46%) Frame 1
68416.m07078 expressed protein similar to PrMC3 [Pinus radiata] GI:5487873
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g27320.1 Score 327 E Value 5e-90 Identity 23.20% Align. Length 659bp (93.74%) Frame 1
68418.m03262 expressed protein similar to PrMC3 [Pinus radiata] GI:5487873
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB87746.1| Score 361 E Value 9e-99 Identity 26.30% Align. Length 650bp (92.46%) Frame 1
putative protein [Arabidopsis thaliana] ref|NP_191860.1| expressed protein [Arabidopsis thaliana] pir||T48090 hypothetical protein T20O10.110 - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAM91129.1| Score 327 E Value 2e-88 Identity 23.20% Align. Length 659bp (93.74%) Frame 1
unknown protein [Arabidopsis thaliana] ref|NP_198084.1| expressed protein [Arabidopsis thaliana] gb|AAK96844.1| Unknown protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0011M04
Clone
Clone name
hba-11m4
LE_HBa0011M04
P011M04
Clone type
BAC
Contamination
none
Estimated length
137,976
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found