Clone Read LE_HBa0011M24_T7_5687

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0011M24_T7_5687
Primer
T7
ID from Seq. Facility
LE_HBa_011_M24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
762 trimmed for vector and quality, 912 raw
Genbank Accession
Sequence
>LE_HBa0011M24_T7_5687 (raw untrimmed)
GGGGGACTGGGTCCGGAGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTTCCACGAAACAGCAATAGACGATTCAACACTATTGATAAGATTA
AAGTCGGAGATGAGATATCTGACTGAGCCCGCTGAGATACAAAAGGAGATCACAGAGTACTATGAGAAGTTATATGCTGAAACCTAGGACTGGAGACCAG
ACTTAGAAATGTTAGGGTGCCCTACGATTGATAAGATGACAATAACCAATTGATGGCCCCTTTTGGAAGCACAGGAAATCCTAGAAAAGGCATCAAAGCC
TGTGTCGTTGACAAGGCCCCTGGCCCAGATGGTTTCTCCATGGCTTTCTTTAGCCAATTATGAGAAGTCATCAATAAAGAAGTGGTGGAAGTAATTCAAA
ACTTCCATGAGGATAGGGTATTTGAGAAGAGTATAAGTGCTACTTTTGTGACCTCGATACCAAAAAAGACGGGGGCTGTGGAACTAACACTATGTTTGGA
TCATTGTTATCCATTGTATTGTATTGTATCGTTACTATACCTACAATGTCTGTTTTGATTATTACTTAAAATATATTGTACTGTATTGTTAAATTTCGTT
GTTACTTAACAATGGAACTTCCTATTTAATAGAACAACCAATTTGGTGTGTTCCCATTGTTACTTAATTTATTTTTCCAATTATATATTTACATAATATT
TCAAGATACTATTTTACCCTTTACCTTAATAATTTAGACCTAGTCAAACCTCTTACCTTAGAACAATTAAGGATATTTAAGTAAATTTATAAATTACAAT
ACAGTACGATACAATCAAACCAAACATTAAAATGTTATTAAACAACAATAAACATATAATCTAGTCAACCATGTATTTACCATACATACAATGCATAGAG
TACATATAAAAT
>LE_HBa0011M24_T7_5687 (trimmed for quality and cloning vector)
CTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTTCCACGAAACAGCAATAGACGATTCAACACTATTGATAAGATTAAAGTCGGAGATGAGATATCTGAC
TGAGCCCGCTGAGATACAAAAGGAGATCACAGAGTACTATGAGAAGTTATATGCTGAAACCTAGGACTGGAGACCAGACTTAGAAATGTTAGGGTGCCCT
ACGATTGATAAGATGACAATAACCAATTGATGGCCCCTTTTGGAAGCACAGGAAATCCTAGAAAAGGCATCAAAGCCTGTGTCGTTGACAAGGCCCCTGG
CCCAGATGGTTTCTCCATGGCTTTCTTTAGCCAATTATGAGAAGTCATCAATAAAGAAGTGGTGGAAGTAATTCAAAACTTCCATGAGGATAGGGTATTT
GAGAAGAGTATAAGTGCTACTTTTGTGACCTCGATACCAAAAAAGACGGGGGCTGTGGAACTAACACTATGTTTGGATCATTGTTATCCATTGTATTGTA
TTGTATCGTTACTATACCTACAATGTCTGTTTTGATTATTACTTAAAATATATTGTACTGTATTGTTAAATTTCGTTGTTACTTAACAATGGAACTTCCT
ATTTAATAGAACAACCAATTTGGTGTGTTCCCATTGTTACTTAATTTATTTTTCCAATTATATATTTACATAATATTTCAAGATACTATTTTACCCTTTA
CCTTAATAATTTAGACCTAGTCAAACCTCTTACCTTAGAACAATTAAGGATATTTAAGTAAA

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.958487
Expected error %
0.218187
Sequence Annotations 
Automatic Annotations
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|L24367.1:218-930 Score 66 E Value 5e-12 Identity 100.00% Align. Length 32bp (4.20%) Frame 2
Cloning vector pTugAS (derived from E. coli JM105) beta-lactamase and repressor protein gene, complete cds
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|X65303.1:1-108 Score 64 E Value 2e-11 Identity 100.00% Align. Length 31bp (4.07%) Frame 2
Cloning vector pGEM-4
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0011M24
Clone
Clone name
hba-11m24
LE_HBa0011M24
P011M24
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found