Clone Read LE_HBa0101L21_T7_57017

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0101L21_T7_57017
Primer
T7
ID from Seq. Facility
LE_HBa_101_L21-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
710 trimmed for vector and quality, 770 raw
Genbank Accession
Sequence
>LE_HBa0101L21_T7_57017 (raw untrimmed)
CTCGGGTCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAATGATCAGAATACGTTGTTATTATCAAAACTTGATTAGCTTCAACTTTCAA
GAAGAATGAATTGAACAACGATGTTCAAAGGTGCGGTCTAGAGGTCAATGAAGAGGTTGAGAACCATGAGGTCTCGGGTTCAAACACTAGGTGATTTCCT
CTCTGTGTCCGAACTTCGGCAAACAGAGTTACCTTGTAGTTGTACCGGAGGGAGGTAGTATGTACCTATGAATTTAGTTGAGGTGTCCCCAAGTTGGTCC
GTACACCACGGCTATTAAAAGAAATCAATTGAATAACAAACATGATGATCATCACCACTAGTTCTGATGTTCTTTTTCAATGAAAACTGATTAAATATGT
ATTTTGGTAAAGATTATGAAGTTGAATACTGTTCTTGATAATGATGGATGGATTAACATTTATAATATATGATCTATAGAATTTAAAACATTGTTAGCGA
AGCTAATGAAGTCTGATCCTTGACAATTGCAGACTGCTATTCCAATACTAATTGGGACCAAATTTGATGATTTTGTTCAGCTTCCGCCAGACATTCAATG
GTCTGTGGTGACACAGGTACAATTCTGATCAACGTAATTTACTTAAATGGTTCCTTCATTCCTTCTCCTAAATGGCATTTTAAGCCTTTTATCACTAATC
AACAACCACTAACATAACATAGTGCAGTCCCACTAAGTGGGGTTCGGGAAGGGTAAAAGTGATGCTAATT
>LE_HBa0101L21_T7_57017 (trimmed for quality and cloning vector)
AGCTTAATGATCAGAATACGTTGTTATTATCAAAACTTGATTAGCTTCAACTTTCAAGAAGAATGAATTGAACAACGATGTTCAAAGGTGCGGTCTAGAG
GTCAATGAAGAGGTTGAGAACCATGAGGTCTCGGGTTCAAACACTAGGTGATTTCCTCTCTGTGTCCGAACTTCGGCAAACAGAGTTACCTTGTAGTTGT
ACCGGAGGGAGGTAGTATGTACCTATGAATTTAGTTGAGGTGTCCCCAAGTTGGTCCGTACACCACGGCTATTAAAAGAAATCAATTGAATAACAAACAT
GATGATCATCACCACTAGTTCTGATGTTCTTTTTCAATGAAAACTGATTAAATATGTATTTTGGTAAAGATTATGAAGTTGAATACTGTTCTTGATAATG
ATGGATGGATTAACATTTATAATATATGATCTATAGAATTTAAAACATTGTTAGCGAAGCTAATGAAGTCTGATCCTTGACAATTGCAGACTGCTATTCC
AATACTAATTGGGACCAAATTTGATGATTTTGTTCAGCTTCCGCCAGACATTCAATGGTCTGTGGTGACACAGGTACAATTCTGATCAACGTAATTTACT
TAAATGGTTCCTTCATTCCTTCTCCTAAATGGCATTTTAAGCCTTTTATCACTAATCAACAACCACTAACATAACATAGTGCAGTCCCACTAAGTGGGGT
TCGGGAAGGG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.964728
Expected error %
0.615449
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0101L21
Clone
Clone name
hba-101l21
LE_HBa0101L21
P101L21
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found