Clone Read LE_HBa0101M13_SP6_57048

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0101M13_SP6_57048
Primer
SP6
ID from Seq. Facility
LE_HBa_101_M13-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
524 trimmed for vector and quality, 812 raw
Genbank Accession
Sequence
>LE_HBa0101M13_SP6_57048 (raw untrimmed)
GGTTTTTGCCATTTCTCCATGTGTGAGTTTTGGCTAGATGCAGTGTCCTTCTTAGGGCATGTGGTTTCTCAGGTATGGGGTGATGGTGGATCCCTCTAAG
ATTGAGACAGTGAAGAATTGGGTAAGACCTACTAATGTGTCAGAAATAAGGAGCTTTGTTGGTTTAGCTAGCTATTACCGTCGATTTGTCAAGGGATTCT
CTTCTATTGCTTCCCAATTGACGAACTTGACTAAGCATAATGTTCCATTTGTATGGTCGGATGAATGTGAAGAAAGCTTTCAGAAGCTCAAGACCTTGTT
GACTACTGCACCAATCCTTACCCTGCCAGTGGAAGGTAAGAATTTCATTGTCTATTGTGATGCATCCTATTCGGGTTTGGGTGCAGTGCTAATGCAAGAG
AAGAACGTAATTGCTTATGCTTCAAGGCCATTAAAGGTGCACGAACGTAATTATCCGACCCATGATTTGGAATTGGTTGCTGTAGTGTTTGCCTTAAAGC
AATGGAGACACTATCTATATGGGGTTAAGTGTGAAGTATACACGGATCATCGTAGTCTACAGTATGTCTTTACTCAAAAATATTTTAATTTGATACAGAG
GAGATGGATGGAACTACTTGATATGACTACCATTTCTCCTATCTTATATCATCTGGTAAAAGGTTAATGTTATTGGCCCAACGTCTCAATGTAAAAAAGT
ATACATCATGGCGAAGTCTTAGTTCTTCTTGCTCTATTTCTCAACTTTCCATTTTCCTAAATAAGACCTCGTACATCATTAATTACCGATCTATTGCGTA
TTTGCTACTTTC
>LE_HBa0101M13_SP6_57048 (trimmed for quality and cloning vector)
GTGAGTTTTGGCTAGATGCAGTGTCCTTCTTAGGGCATGTGGTTTCTCAGGTATGGGGTGATGGTGGATCCCTCTAAGATTGAGACAGTGAAGAATTGGG
TAAGACCTACTAATGTGTCAGAAATAAGGAGCTTTGTTGGTTTAGCTAGCTATTACCGTCGATTTGTCAAGGGATTCTCTTCTATTGCTTCCCAATTGAC
GAACTTGACTAAGCATAATGTTCCATTTGTATGGTCGGATGAATGTGAAGAAAGCTTTCAGAAGCTCAAGACCTTGTTGACTACTGCACCAATCCTTACC
CTGCCAGTGGAAGGTAAGAATTTCATTGTCTATTGTGATGCATCCTATTCGGGTTTGGGTGCAGTGCTAATGCAAGAGAAGAACGTAATTGCTTATGCTT
CAAGGCCATTAAAGGTGCACGAACGTAATTATCCGACCCATGATTTGGAATTGGTTGCTGTAGTGTTTGCCTTAAAGCAATGGAGACACTATCTATATGG
GGTTAAGTGTGAAGTATACACGGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.971468
Expected error %
0.202162
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 219 E Value 3e-59 Identity 66.70% Align. Length 519bp (99.05%) Frame 1
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 219 E Value 2e-59 Identity 66.00% Align. Length 519bp (99.05%) Frame 1
putative polyprotein, 3'-partial [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0101M13
Clone
Clone name
hba-101m13
LE_HBa0101M13
P101M13
Clone type
BAC
Contamination
none
Estimated length
133,573
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found