Clone Read LE_HBa0101O15_SP6_57148

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0101O15_SP6_57148
Primer
SP6
ID from Seq. Facility
LE_HBa_101_O15-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
577 trimmed for vector and quality, 797 raw
Genbank Accession
Sequence
>LE_HBa0101O15_SP6_57148 (raw untrimmed)
ATTTCCTAAACTTCGCCATTTCAGGTCATAAGGACTCCAAAGTAAGTCATTGATACCATATGAAAATTCTCCTCCAGCAGCAGACACATCTCTGTTTGCA
AAAATAGTAGCTTTATCCTTAAGAACCTCGCGAGCTAAAGCAGGCGAACTAATAATAATCCCAATTTTTTTACCAAGCCAGATTCTACAAATGGGGCCAT
ATGTTTTGGACAGAGATGCAAAATAGGTGTGAAGTTCAGGATCAAGAGAATGGAGATTACCTATCAAGGGCAAAGCTTCAGGCCCTGGTGGCAATCCCTT
GTTTGAGTTTCTGATGAAACACCAAAGTAAAGCTAAGAACCCAAGAAAACAGGAGAAAAACACACCCTTTTGCTCAACATTGAGTTGTTGTAGGGGCCAT
GGAAAAGAATCAAAAAGGGGTTTGAAGAATTTGAGAGACATCTGAAGCTTTTGCACAGCTAAAAGTTTTTTTTTTTTTGATTTTGCTGAAGGAATGAGAT
GAATATAAATAGATAAAAACGAAGCAGAGTCACCCCTTGAATCTCGTGATGTTAATTGAAACGGAAAAAGTAGTTTGTTTAGTATCATAAGAAACGTGGA
AAGGAGCAAAATTTGTTTGGCATTTTGTGATCAGTCAAATTCATCAAAAAATTCGTTTCTTTTTTTGGATTTATCCCCTTACCAAATTTTACCTTCTTTC
ACAACCATGGGCTTTCAAATTTCATAATAGATGCCCTTTATTTATTTTATCTCCTTTCATTTTTTTTTTTTTATCATTTATTTTTTTTTAAATTTTT
>LE_HBa0101O15_SP6_57148 (trimmed for quality and cloning vector)
AAGGACTCCAAAGTAAGTCATTGATACCATATGAAAATTCTCCTCCAGCAGCAGACACATCTCTGTTTGCAAAAATAGTAGCTTTATCCTTAAGAACCTC
GCGAGCTAAAGCAGGCGAACTAATAATAATCCCAATTTTTTTACCAAGCCAGATTCTACAAATGGGGCCATATGTTTTGGACAGAGATGCAAAATAGGTG
TGAAGTTCAGGATCAAGAGAATGGAGATTACCTATCAAGGGCAAAGCTTCAGGCCCTGGTGGCAATCCCTTGTTTGAGTTTCTGATGAAACACCAAAGTA
AAGCTAAGAACCCAAGAAAACAGGAGAAAAACACACCCTTTTGCTCAACATTGAGTTGTTGTAGGGGCCATGGAAAAGAATCAAAAAGGGGTTTGAAGAA
TTTGAGAGACATCTGAAGCTTTTGCACAGCTAAAAGTTTTTTTTTTTTTGATTTTGCTGAAGGAATGAGATGAATATAAATAGATAAAAACGAAGCAGAG
TCACCCCTTGAATCTCGTGATGTTAATTGAAACGGAAAAAGTAGTTTGTTTAGTATCATAAGAAACGTGGAAAGGAG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.951456
Expected error %
0.282675
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g12300.1 Score 112 E Value 1e-25 Identity 16.50% Align. Length 308bp (53.38%) Frame 3
68417.m01948 cytochrome P450 family protein flavonoid 3',5'-hydroxylase - Campanula medium, PID:d1003951
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g44620.1 Score 106 E Value 1e-23 Identity 16.70% Align. Length 299bp (51.82%) Frame 3
68418.m05467 cytochrome P450 family protein similar to cytocrhome P450 monooxygenase (GI:14334057) [Gossypium arboreum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB78273.1| Score 112 E Value 5e-24 Identity 16.50% Align. Length 308bp (53.38%) Frame 3
flavonoid 3', 5'-hydroxylase-like protein [Arabidopsis thaliana] emb|CAB45977.1| flavonoid 3', 5'-hydroxylase-like protein [Arabidopsis thaliana] dbj|BAC43375.1| putative flavonoid 3',5'-hydroxylase [Arabidopsis thaliana] gb|AAO63874.1| putative cytochrome p450 [Arabidopsis thaliana] ref|NP_192967.1| cytochrome P450 family protein [Arabidopsis thaliana] pir||T48140 flavonoid 3',5'-hydroxylase homolog T4C9.140 [similarity] - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAG34695.1| Score 110 E Value 2e-23 Identity 17.00% Align. Length 305bp (52.86%) Frame 3
putative cytochrome P450 [Matthiola incana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0101O15
Clone
Clone name
hba-101o15
LE_HBa0101O15
C08HBa0101O15
P101O15
Clone type
BAC
Contamination
none
Estimated length
118,518
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found