Notice: SGN will be briefly unavailable for maintenance. Apologies.

Clone Read LE_HBa0122C17_SP6_57344

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0122C17_SP6_57344
Primer
SP6
ID from Seq. Facility
LE_HBa_122_C17-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
699 trimmed for vector and quality, 802 raw
Sequence
>LE_HBa0122C17_SP6_57344 (raw untrimmed)
TTGATTGTACTCATCTATATTTTGCAGATGACCTGTTATTGTTTGCTAGAGGTGATCTTGAGTCTGTTAAAGCCATCCAATCATGTTTCTCTCATTTTTC
CCAATCCTCAGGGTTGCAGGCTAACCTTAATAAGAGTTCAATATACTGTGGAGGTTTGCAAAGAGAAGTGAGGCAACAGATTGTTCAGCAGCTGGGATAC
AACATGGAAGAATTGCCTTTCAAATATCTGGGAGTTCCTTTATCAACTAAGAAAATGTCAGTTCTGCAATGGCATCCACTTATTGATAGAATAATGGCAT
GAATCAATTCTTGGACAGCTAGGAAACTATGCTATGCAGGGAGAGGTCAACTGGTGCAGACAGTGTTATTTGGTGTTCAATCTTATTGGGCACAATTGTT
CATCATTCCAGCTAAGATAATCAAGCTGATTGAGAGTCTGTGTAGAAGCTACTTATGGTCAGGGACTGGACATGTTACTAAGAAGGCTTTAATAGCATGG
GAGCAAGTTTGTAGGCCTAAAAGTGAAGGTGGTATGGGTTGATAAACATGGAAATATGGAATAGAGCAGCAGTAGCTAAACTTTGTTGGGACTTGGCAAA
CAAAGAAGACAAGTTATGGATTAAATGGATTCATGCTTACAACTTAAAAGATCAGAGTGAATGACAAAAGAGAGATCAAGCCAGCTGGATGATCAGGAAA
ATTTTGAATGCCAAGCACATAGTTGATCAGTGTCAACCCAGGTAAGGAAAAGGGGGTGATCCAGCACTTTTTTGACTATCTTAAAGGGGAGAAAATCCAA
CC
>LE_HBa0122C17_SP6_57344 (trimmed for quality and cloning vector)
TATATTTTGCAGATGACCTGTTATTGTTTGCTAGAGGTGATCTTGAGTCTGTTAAAGCCATCCAATCATGTTTCTCTCATTTTTCCCAATCCTCAGGGTT
GCAGGCTAACCTTAATAAGAGTTCAATATACTGTGGAGGTTTGCAAAGAGAAGTGAGGCAACAGATTGTTCAGCAGCTGGGATACAACATGGAAGAATTG
CCTTTCAAATATCTGGGAGTTCCTTTATCAACTAAGAAAATGTCAGTTCTGCAATGGCATCCACTTATTGATAGAATAATGGCATGAATCAATTCTTGGA
CAGCTAGGAAACTATGCTATGCAGGGAGAGGTCAACTGGTGCAGACAGTGTTATTTGGTGTTCAATCTTATTGGGCACAATTGTTCATCATTCCAGCTAA
GATAATCAAGCTGATTGAGAGTCTGTGTAGAAGCTACTTATGGTCAGGGACTGGACATGTTACTAAGAAGGCTTTAATAGCATGGGAGCAAGTTTGTAGG
CCTAAAAGTGAAGGTGGTATGGGTTGATAAACATGGAAATATGGAATAGAGCAGCAGTAGCTAAACTTTGTTGGGACTTGGCAAACAAAGAAGACAAGTT
ATGGATTAAATGGATTCATGCTTACAACTTAAAAGATCAGAGTGAATGACAAAAGAGAGATCAAGCCAGCTGGATGATCAGGAAAATTTTGAATGCCAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.955108
Expected error %
0.0309671
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g24255.1 Score 140 E Value 9e-34 Identity 14.60% Align. Length 452bp (64.66%) Frame 1
68416.m03045 expressed protein
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g52065.1 Score 110 E Value 2e-26 Identity 41.10% Align. Length 553bp (79.11%) Frame 1
68418.m06463 hypothetical protein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB72467.1| Score 155 E Value 2e-40 Identity 42.80% Align. Length 685bp (98.00%) Frame 1
putative protein [Arabidopsis thaliana] pir||T47440 hypothetical protein T18B22.50 - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAB09379.1| Score 154 E Value 3e-41 Identity 39.90% Align. Length 685bp (98.00%) Frame 1
non-LTR retroelement reverse transcriptase-like protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0122C17
Clone
Clone name
hba-122c17
LE_HBa0122C17
C03HBa0122C17
P122C17
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found