Clone Read LE_HBa0122C17_T7_57345

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0122C17_T7_57345
Primer
T7
ID from Seq. Facility
LE_HBa_122_C17-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
690 trimmed for vector and quality, 802 raw
Sequence
>LE_HBa0122C17_T7_57345 (raw untrimmed)
CCTCGGTCCCGCGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGTGCTTTCCCCTTTCTCTCGATCGTTTCTCTCTCTCCCTTCTTATTCTTT
CTATTTTCTTATTTCAAACCCTCTTTCTTTTACCCTAATTAGTGTATAATTAAGGATAAAAGATGGCAATAATGCCCCACTAATTAACTTAAGGTTACCT
CTTTTAACCCCCAAGTAATTAGACTTATTAACATTAACCCACTAACTTTATAATTAAGGCAAGAATAGTCAAAAAAAGTCCCTTAAAACGTATCAAGAAA
TCCAACCCGGACTGAGATTGCGCAACCTGTGACGGGCCGTCGCGCCTGCGACGGTCCGTCCTGCTGTATATCGCATAGTTCAGAAACTTGATTTTGGGTG
AATGGCCTGTGACGGTCCGTCCTGCCACTCCGTTACGAAGTTCAGAGAGTCGATTTTCAGTACCCAATTTCAGATTTTCTAAGTGTTTGGAAACGAGACC
CTGCGACGGTCCGTCGTGCCCATGACGGATCGTCGTTGAGTCCGTCGCCTCAGCCTGTTTTTCCAGAAATAAAATCTGCTGCTCAAGACGACTCAACAGG
TCGTTACATTAGATACCAATTTACCCATCGTTCGTCCCCGAACGATCACAAGAAGGAAAACAAGGGCGAAAAGGAGTACCTGAATCTGTAAACAAATGTG
GGTTATTTTTCTCGCATATTCCGCCTCCTTCTCCCAAATTGGCTTCTTCACAGGTTCATTCTTCCATTGCACCTTGAATGAATGTAATCTCTCCTGAACC
TA
>LE_HBa0122C17_T7_57345 (trimmed for quality and cloning vector)
AGCTTGGTGCTTTCCCCTTTCTCTCGATCGTTTCTCTCTCTCCCTTCTTATTCTTTCTATTTTCTTATTTCAAACCCTCTTTCTTTTACCCTAATTAGTG
TATAATTAAGGATAAAAGATGGCAATAATGCCCCACTAATTAACTTAAGGTTACCTCTTTTAACCCCCAAGTAATTAGACTTATTAACATTAACCCACTA
ACTTTATAATTAAGGCAAGAATAGTCAAAAAAAGTCCCTTAAAACGTATCAAGAAATCCAACCCGGACTGAGATTGCGCAACCTGTGACGGGCCGTCGCG
CCTGCGACGGTCCGTCCTGCTGTATATCGCATAGTTCAGAAACTTGATTTTGGGTGAATGGCCTGTGACGGTCCGTCCTGCCACTCCGTTACGAAGTTCA
GAGAGTCGATTTTCAGTACCCAATTTCAGATTTTCTAAGTGTTTGGAAACGAGACCCTGCGACGGTCCGTCGTGCCCATGACGGATCGTCGTTGAGTCCG
TCGCCTCAGCCTGTTTTTCCAGAAATAAAATCTGCTGCTCAAGACGACTCAACAGGTCGTTACATTAGATACCAATTTACCCATCGTTCGTCCCCGAACG
ATCACAAGAAGGAAAACAAGGGCGAAAAGGAGTACCTGAATCTGTAAACAAATGTGGGTTATTTTTCTCGCATATTCCGCCTCCTTCTCC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.980937
Expected error %
0.782556
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0122C17
Clone
Clone name
hba-122c17
LE_HBa0122C17
C03HBa0122C17
P122C17
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found