Clone Read LE_HBa0122H22_T7_57595

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0122H22_T7_57595
Primer
T7
ID from Seq. Facility
LE_HBa_122_H22-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
718 trimmed for vector and quality, 778 raw
Sequence
>LE_HBa0122H22_T7_57595 (raw untrimmed)
CTGGGTCCCGCGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTCTGACTAGCCAGCAGACCATAATTTTAATCAAAGTGTCCCAGCTGGGCGTT
GTAGAAAGAGACCACTGTCTTGTGCATTCAGTCCACTAGTAATGACTGCCCCGACATGGTTCCATTATTTATTTATTTTTGATGAAGTAATAGAAGATGT
CATAGAAGCGACTACCTTACTTAAGCAATTCTTCTTATTCTTCTTCTTTCTTAGTTGAAGTTCCTATATTGGTTTTTTCTTTCTTTTATGAATGTTATTA
CGGGCATGACATGGTTCCATTATTTGAGTAAGCCCCGGTAAGGCTTAGACACTTGTATTTGTCCATCCCTTACCTTGACTCTTGACTGCTCCCAGTTCGA
TTGTTTGCTTCTCGTGAATTTAGTATCCAATCCTATATGTCTAATATTCATCATTTGCGTTCTCTTCACCATATCATACCATCTGGCACCATCTTCTATG
TTTCTGGGACATAAAAAGGAGAGTCAGTGTTGTTGTGGAAAAGATTTGAGCTCAACTAGGGGTTCCACAATTTGTCCTTCCTTGACATGGAATCAGTATG
CTATAATAATCTAGCTCCCCATAGGTGTTGCTGCCATTTTATGTTCTTTTGTCCTTGTTCAAAGATACCCAGGAAAAATATCCCATCCAACCTGTTTATG
GGTTCATTTTTATGAAAAGCATTCTTGTACTTGAATTTGTTTCGGTTTTGGCAGTTTGATTGTTTAAATGTGGATTAA
>LE_HBa0122H22_T7_57595 (trimmed for quality and cloning vector)
AGCTTTCTGACTAGCCAGCAGACCATAATTTTAATCAAAGTGTCCCAGCTGGGCGTTGTAGAAAGAGACCACTGTCTTGTGCATTCAGTCCACTAGTAAT
GACTGCCCCGACATGGTTCCATTATTTATTTATTTTTGATGAAGTAATAGAAGATGTCATAGAAGCGACTACCTTACTTAAGCAATTCTTCTTATTCTTC
TTCTTTCTTAGTTGAAGTTCCTATATTGGTTTTTTCTTTCTTTTATGAATGTTATTACGGGCATGACATGGTTCCATTATTTGAGTAAGCCCCGGTAAGG
CTTAGACACTTGTATTTGTCCATCCCTTACCTTGACTCTTGACTGCTCCCAGTTCGATTGTTTGCTTCTCGTGAATTTAGTATCCAATCCTATATGTCTA
ATATTCATCATTTGCGTTCTCTTCACCATATCATACCATCTGGCACCATCTTCTATGTTTCTGGGACATAAAAAGGAGAGTCAGTGTTGTTGTGGAAAAG
ATTTGAGCTCAACTAGGGGTTCCACAATTTGTCCTTCCTTGACATGGAATCAGTATGCTATAATAATCTAGCTCCCCATAGGTGTTGCTGCCATTTTATG
TTCTTTTGTCCTTGTTCAAAGATACCCAGGAAAAATATCCCATCCAACCTGTTTATGGGTTCATTTTTATGAAAAGCATTCTTGTACTTGAATTTGTTTC
GGTTTTGGCAGTTTGATT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.955693
Expected error %
0.729437
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0122H22
Clone
Clone name
hba-122h22
LE_HBa0122H22
P122H22
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found