Clone Read LE_HBa0122I24_SP6_57646

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0122I24_SP6_57646
Primer
SP6
ID from Seq. Facility
LE_HBa_122_I24-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
675 trimmed for vector and quality, 774 raw
Sequence
>LE_HBa0122I24_SP6_57646 (raw untrimmed)
GATTTTCTTATGTCGAGGATTAGATTTTTCTGATATATACACAATTAGTCTTTACGGTAGTTTCAACAAAGGGCTTATACCAGAGCCCTCATTACCTGTG
GGTCCACCAGTGGTTCTTGTCATGGAGTTGCTGTTTTTTAGTGCATAACTGGTTCTCGTATTGTCCACAGATGGGTATTAGCACAGTCGACTCCTCAGTT
GCTGGTCTCGGAGGCTGTCCATATGCCAAAGGAGCTTCTGGCAATGTTGCAACAGAAGATGTTGTCTACATGCTCAATGGTCTAGGGATTAAAACCAATG
TCGATCTACAGAAACTCCTGCTAGCCGGGGAGTTCATCAGCAAGCATTTGGACCGCCCATCCGGATCCAAAGCAGCCATTGCTTTGACCGGAGTAACAGC
AGATGCATCCAAGATGTAGGAAGGTAAACCACTCCCAGATGTGATCAAATGGTCTCATCAAGAAGTGCAAAAACCAGAATATAGAGTAGAAGAGATGCCA
CTTCTATAGTGTATACTTATCAAAATATGGCCATAAATAATCTATTTGTGACTGTCTGTGACAATGAACATGCCATTATTTAGACAACATCAAGCTGCTC
ATTGCAGCATATATCTAATACAAAGTGATTATTGATTTATACTTCCCTTATTCTCTTCTTTATGTTTGCTCAACTTGTGTTGGAATTGTTTCTTTCCTAT
TTGTCATTGTTCTTTTTTGTTTAATAACTCCCTCCGTCCACTTTTTTTTTGTCATGTTGCAATTTTTTGAAAGT
>LE_HBa0122I24_SP6_57646 (trimmed for quality and cloning vector)
GATATATACACAATTAGTCTTTACGGTAGTTTCAACAAAGGGCTTATACCAGAGCCCTCATTACCTGTGGGTCCACCAGTGGTTCTTGTCATGGAGTTGC
TGTTTTTTAGTGCATAACTGGTTCTCGTATTGTCCACAGATGGGTATTAGCACAGTCGACTCCTCAGTTGCTGGTCTCGGAGGCTGTCCATATGCCAAAG
GAGCTTCTGGCAATGTTGCAACAGAAGATGTTGTCTACATGCTCAATGGTCTAGGGATTAAAACCAATGTCGATCTACAGAAACTCCTGCTAGCCGGGGA
GTTCATCAGCAAGCATTTGGACCGCCCATCCGGATCCAAAGCAGCCATTGCTTTGACCGGAGTAACAGCAGATGCATCCAAGATGTAGGAAGGTAAACCA
CTCCCAGATGTGATCAAATGGTCTCATCAAGAAGTGCAAAAACCAGAATATAGAGTAGAAGAGATGCCACTTCTATAGTGTATACTTATCAAAATATGGC
CATAAATAATCTATTTGTGACTGTCTGTGACAATGAACATGCCATTATTTAGACAACATCAAGCTGCTCATTGCAGCATATATCTAATACAAAGTGATTA
TTGATTTATACTTCCCTTATTCTCTTCTTTATGTTTGCTCAACTTGTGTTGGAATTGTTTCTTTCCTATTTGTCA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.977968
Expected error %
0.692202
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g26800.2 Score 135 E Value 2e-32 Identity 27.30% Align. Length 248bp (36.74%) Frame 3
68415.m03215 hydroxymethylglutaryl-CoA lyase, putative / 3-hydroxy-3-methylglutarate-CoA lyase, putative / HMG-CoA lyase, putative similar to SP|P35915 Hydroxymethylglutaryl-CoA lyase (EC 4.1.3.4) (HMG-CoA lyase) {Gallus gallus}; contains Pfam profile PF00682: HMGL-like
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g26800.1 Score 135 E Value 2e-32 Identity 27.30% Align. Length 248bp (36.74%) Frame 3
68415.m03214 hydroxymethylglutaryl-CoA lyase, putative / 3-hydroxy-3-methylglutarate-CoA lyase, putative / HMG-CoA lyase, putative similar to SP|P35915 Hydroxymethylglutaryl-CoA lyase (EC 4.1.3.4) (HMG-CoA lyase) {Gallus gallus}; contains Pfam profile PF00682: HMGL-like
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAK15568.1| Score 135 E Value 9e-31 Identity 27.30% Align. Length 248bp (36.74%) Frame 3
putative hydroxymethylglutaryl-CoA lyase [Arabidopsis thaliana] gb|AAG42010.1| putative hydroxymethylglutaryl-CoA lyase [Arabidopsis thaliana] gb|AAC32247.2| putative hydroxymethylglutaryl-CoA lyase [Arabidopsis thaliana] ref|NP_565629.1| hydroxymethylglutaryl-CoA lyase, putative / 3-hydroxy-3-methylglutarate-CoA lyase, putative / HMG-CoA lyase, putative [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAN15400.1| Score 135 E Value 9e-31 Identity 27.30% Align. Length 248bp (36.74%) Frame 3
putative hydroxymethylglutaryl-CoA lyase [Arabidopsis thaliana] gb|AAM91612.1| putative hydroxymethylglutaryl-CoA lyase [Arabidopsis thaliana] ref|NP_850087.1| hydroxymethylglutaryl-CoA lyase, putative / 3-hydroxy-3-methylglutarate-CoA lyase, putative / HMG-CoA lyase, putative [Arabidopsis thaliana] pir||T02655 hydroxymethylglutaryl-CoA lyase (EC 4.1.3.4) - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0122I24
Clone
Clone name
hba-122i24
LE_HBa0122I24
P122I24
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found