Clone Read LE_HBa0122I24_T7_57647

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0122I24_T7_57647
Primer
T7
ID from Seq. Facility
LE_HBa_122_I24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
431 trimmed for vector and quality, 796 raw
Sequence
>LE_HBa0122I24_T7_57647 (raw untrimmed)
CTTGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTAAGTATCTTGCGTCCATTATCCATCATAAGGATAGATGATGATGATGTCAC
GCATCGTATTCCCATTGAGGTAGGTGAAATGGAGGCTTGCCTCTAAGATAGAAATGCATCGCCAAGGCTTAATGGTAAGTTTACAAAATGGTGGATAGAC
CAAAATTGTTGAATAGGGTAAAATGTTGGCCAAGTAAGAACACATTCAGAAGATCAATGTAGATGAGATAAGGACGCTCAGATACATGTGTAATGTGTGG
GCATACTCATAGATACATGATTAGGAATGAAGTATGGGAAAAAGTGAGAGTGGTATCAGTGGCGGACAAGATGGTGGAAACAAAATTGTGATGGTTCGTA
CATGTGAACATGAGGTGTGAGGATGTGTCAGTAAGGTGTGGGAGGTTGGCTGTAGTAGGAGTTAGGAGAGGTAAAGGGGAGGCCTTAATTTATCTCGTAA
AGGCGTTTTCTATTGTTCATACTCTACTTTCTCTTCTCATTGTACACGTCTCTTAGATTTGATGTTTGTGATTTACTGTTTTATCAGTATACTTTTCTCC
ATTTTATTTCTTTGCTTCTATTTTTTATTCTTCGTGTCGCTCTTCTGTGTGATGGGTTACCATCTTTAATCTATACTTTCATTAACAGTTATCTATAATC
TGTTATTTAGTTATAAATACAACTTGTCGGCACCAATCTTATGAATTAAAGCACCTACATACCTTGTCTATACTTCTATTTAATTGTATCTAAAGC
>LE_HBa0122I24_T7_57647 (trimmed for quality and cloning vector)
AGCTTTAAGTATCTTGCGTCCATTATCCATCATAAGGATAGATGATGATGATGTCACGCATCGTATTCCCATTGAGGTAGGTGAAATGGAGGCTTGCCTC
TAAGATAGAAATGCATCGCCAAGGCTTAATGGTAAGTTTACAAAATGGTGGATAGACCAAAATTGTTGAATAGGGTAAAATGTTGGCCAAGTAAGAACAC
ATTCAGAAGATCAATGTAGATGAGATAAGGACGCTCAGATACATGTGTAATGTGTGGGCATACTCATAGATACATGATTAGGAATGAAGTATGGGAAAAA
GTGAGAGTGGTATCAGTGGCGGACAAGATGGTGGAAACAAAATTGTGATGGTTCGTACATGTGAACATGAGGTGTGAGGATGTGTCAGTAAGGTGTGGGA
GGTTGGCTGTAGTAGGAGTTAGGAGAGGTAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.941352
Expected error %
0.377802
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT40504.1| Score 70 E Value 9e-12 Identity 46.40% Align. Length 376bp (87.24%) Frame 3
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0122I24
Clone
Clone name
hba-122i24
LE_HBa0122I24
P122I24
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found