Clone Read LE_HBa0122K04_T7_57703

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0122K04_T7_57703
Primer
T7
ID from Seq. Facility
LE_HBa_122_K04-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
679 trimmed for vector and quality, 791 raw
Sequence
>LE_HBa0122K04_T7_57703 (raw untrimmed)
CTTGGTACCGTGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCAACAATGGAGGTTTTGGAGAGAAAAATGGAGAGGTTTTTTGTGAGTTGAGG
GTTTAGCTTTGATTGGTGAGTTTAGGGGTATAAAAAGACTCAATAACCAATAATGATCTATTCCCAAATTACCCAAAATACCCATGCACTTATTGGACAA
CTTAACACATTCAAATTTGACTTAAAACTAACGCGGCCAAAACAAGGAGTAAATTACGCGTCGCGGAGGCACTTTTAAGTCTTGTTTCTGGAAAATTTCA
AGACATAATGGTTCGTGGCTGTCCCTCTTGACAGGGCAAGAATTTTTCCCACTGCCTGACGCACAGCCACCACCATATTCTGGCTGGCGCAGCAACTTGG
CTATCCCATGTTTGGGTCCTTTTTGGGGACCCTTTGGCTGGTCCTGGGGCGTCGTTCTTGGAAGTTTTGACCCTTTATATGGTAGTCTAAGCATAGGAAT
CATATATACTCATTTTCACCCTCAAACTATCTCCCAAAATAACACTACAAAACACTATGACACACTAGTTTATCTTCTACTAGTTTCAAAACGTCTTCGA
CATTCTTGGACGTTTCACCTCCAAACACTTACTAACTTTATATACTATCTAAGATAACTATTTTTAAATATTTTATGACTTTAAAACATCATAACATCCC
ATCTTGGGGATCTAGTTCAACCTAACTTCATGTTGAGGGTGTAAAAATCCGCTTAATTCGTATTGGTAGCCAAATATCTATAATAAACATT
>LE_HBa0122K04_T7_57703 (trimmed for quality and cloning vector)
AGCTTCAACAATGGAGGTTTTGGAGAGAAAAATGGAGAGGTTTTTTGTGAGTTGAGGGTTTAGCTTTGATTGGTGAGTTTAGGGGTATAAAAAGACTCAA
TAACCAATAATGATCTATTCCCAAATTACCCAAAATACCCATGCACTTATTGGACAACTTAACACATTCAAATTTGACTTAAAACTAACGCGGCCAAAAC
AAGGAGTAAATTACGCGTCGCGGAGGCACTTTTAAGTCTTGTTTCTGGAAAATTTCAAGACATAATGGTTCGTGGCTGTCCCTCTTGACAGGGCAAGAAT
TTTTCCCACTGCCTGACGCACAGCCACCACCATATTCTGGCTGGCGCAGCAACTTGGCTATCCCATGTTTGGGTCCTTTTTGGGGACCCTTTGGCTGGTC
CTGGGGCGTCGTTCTTGGAAGTTTTGACCCTTTATATGGTAGTCTAAGCATAGGAATCATATATACTCATTTTCACCCTCAAACTATCTCCCAAAATAAC
ACTACAAAACACTATGACACACTAGTTTATCTTCTACTAGTTTCAAAACGTCTTCGACATTCTTGGACGTTTCACCTCCAAACACTTACTAACTTTATAT
ACTATCTAAGATAACTATTTTTAAATATTTTATGACTTTAAAACATCATAACATCCCATCTTGGGGATCTAGTTCAACC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.969696
Expected error %
0.874051
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0122K04
Clone
Clone name
hba-122k4
LE_HBa0122K04
C02HBa0122K04
P122K04
Clone type
BAC
Contamination
none
Estimated length
128,477
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found