Clone Read LE_HBa0122P10_SP6_57954

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0122P10_SP6_57954
Primer
SP6
ID from Seq. Facility
LE_HBa_122_P10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
735 trimmed for vector and quality, 787 raw
Sequence
>LE_HBa0122P10_SP6_57954 (raw untrimmed)
GTATTGGGATATGTTTGAATGAGTAGTAATTTGTTATGAGAGTGAGTGTTGAAAAGTAATCCTTATACTCAAACCTAAATCATTGTGTGAAAATGAGGAT
TTTATTTTGAAGTGAGGACACTAGTTGCAATACTGAAATAAATAGCATCTCGGTGAGAAATTAAAGAGGATAGGTGTTAGTGCATGGTGAGTCTTTGACA
TGGTCTGATTCCACATAATTCAAGCCTAATAGTGATAGCATGTATAAATAATGTTTGCAAAGGATAAAACATAGATACTATTGTACAAAGATTTGTATTG
AGTCATAGTGCGTCTCTTGAGGACAAAAAAACGAATTTAAGTTGAGGGTGTTGATATACCGTGATTTCACGGTATTTTTAATGCTTTTTCCTTAAGTTTA
GTGTGTCCAAAAGCCTTTTTGTACTAATTTTTATGTAAGTTTCTCTTTATTTGTAGAAAATCTGCCTAAAAGATAATTGTGGAGGTTTTTGAGCAAGAAA
TACAGAAAAATACCACCTACGTAGCTTGTGATGGTTCGTCGTGCTCCTGATGGTTCTTAGGTGGCATCGTAGTGAAGCTGCTGAAGGAAGATAAGAAATT
CTTACCAAGTGTGGGCTTACGGAGTGTATGAAAGACCATCGTAGCCATGATTGTTTGTCCTGCTAGTTCTTCATGTAGATCAGAGAAGTAGTCCCAGTAT
CCAAATTCCAAGAGTTTCAAGTATTTTGGAACGGAGACCCTTGACGGACCGTAGTGCCTTTGACGATCCGTCATACCTGCTGTCGAG
>LE_HBa0122P10_SP6_57954 (trimmed for quality and cloning vector)
AATGAGTAGTAATTTGTTATGAGAGTGAGTGTTGAAAAGTAATCCTTATACTCAAACCTAAATCATTGTGTGAAAATGAGGATTTTATTTTGAAGTGAGG
ACACTAGTTGCAATACTGAAATAAATAGCATCTCGGTGAGAAATTAAAGAGGATAGGTGTTAGTGCATGGTGAGTCTTTGACATGGTCTGATTCCACATA
ATTCAAGCCTAATAGTGATAGCATGTATAAATAATGTTTGCAAAGGATAAAACATAGATACTATTGTACAAAGATTTGTATTGAGTCATAGTGCGTCTCT
TGAGGACAAAAAAACGAATTTAAGTTGAGGGTGTTGATATACCGTGATTTCACGGTATTTTTAATGCTTTTTCCTTAAGTTTAGTGTGTCCAAAAGCCTT
TTTGTACTAATTTTTATGTAAGTTTCTCTTTATTTGTAGAAAATCTGCCTAAAAGATAATTGTGGAGGTTTTTGAGCAAGAAATACAGAAAAATACCACC
TACGTAGCTTGTGATGGTTCGTCGTGCTCCTGATGGTTCTTAGGTGGCATCGTAGTGAAGCTGCTGAAGGAAGATAAGAAATTCTTACCAAGTGTGGGCT
TACGGAGTGTATGAAAGACCATCGTAGCCATGATTGTTTGTCCTGCTAGTTCTTCATGTAGATCAGAGAAGTAGTCCCAGTATCCAAATTCCAAGAGTTT
CAAGTATTTTGGAACGGAGACCCTTGACGGACCGT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.956255
Expected error %
0.030003
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0122P10
Clone
Clone name
hba-122p10
LE_HBa0122P10
P122P10
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found