Clone Read LE_HBa0122P10_T7_57955

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0122P10_T7_57955
Primer
T7
ID from Seq. Facility
LE_HBa_122_P10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
738 trimmed for vector and quality, 793 raw
Sequence
>LE_HBa0122P10_T7_57955 (raw untrimmed)
CCTCGGATCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTGATTGAAATGTGTATTTGTTTCTAATAAATTTATAGTGAGTAAGAATAAA
ATGTATGTAGGAAAATGTTACCTCACTGAGGGCCTCTTCAAACTCAATGTAATTGTAGTTGATATGAATAAAATTATACTTCTGCTAACTTGCTTGAGTA
TAAATGTTTATTGCATGAACGTTTGAGACACATTAATAGCAAAACCTTGTGAAAACATATTGACTTAAATGTTTTGCCTAAATTTGAGTGCAATAAATCA
AAATGTCAAGTTTGCATTGAATCTAAGTGTGAAAAGCATCCTATAAATCTATTGAAAGGAATTCATATCCCTTAGAACTGATTCACACTTAAAATGAAGT
CAACACCATCACGTGGTGAAAAAATTATTTTATAACTTTTATTGACAATTGCACTAGATACCATTTATTTCCCAAATGGTATGGATGAATCAATTGATTC
ATTTAGGCAATATAAATTGAAGTTGCAACTCAGTTGGATAAAAAGAATAAAATTACCAGAAGTGATAAAGGTGGAGAATATGAATCTCCATTTGTAGAAA
TATGTTTGGAAAATGGAATTATCCATCAAACTACTGCTCCTTACACTCCTCAATCTAATGGAATTGCGAAAAGGAAAAACCAAACTTTAAAGAAAATGAT
GAATGTCTTACATATAAACTCAGGCTTACCACAAAACTTAATAGGATATGAAAAATAAAAAGGTAGAAAACCTAACTTGAAAATTTTAAGTGG
>LE_HBa0122P10_T7_57955 (trimmed for quality and cloning vector)
AGCTTTGATTGAAATGTGTATTTGTTTCTAATAAATTTATAGTGAGTAAGAATAAAATGTATGTAGGAAAATGTTACCTCACTGAGGGCCTCTTCAAACT
CAATGTAATTGTAGTTGATATGAATAAAATTATACTTCTGCTAACTTGCTTGAGTATAAATGTTTATTGCATGAACGTTTGAGACACATTAATAGCAAAA
CCTTGTGAAAACATATTGACTTAAATGTTTTGCCTAAATTTGAGTGCAATAAATCAAAATGTCAAGTTTGCATTGAATCTAAGTGTGAAAAGCATCCTAT
AAATCTATTGAAAGGAATTCATATCCCTTAGAACTGATTCACACTTAAAATGAAGTCAACACCATCACGTGGTGAAAAAATTATTTTATAACTTTTATTG
ACAATTGCACTAGATACCATTTATTTCCCAAATGGTATGGATGAATCAATTGATTCATTTAGGCAATATAAATTGAAGTTGCAACTCAGTTGGATAAAAA
GAATAAAATTACCAGAAGTGATAAAGGTGGAGAATATGAATCTCCATTTGTAGAAATATGTTTGGAAAATGGAATTATCCATCAAACTACTGCTCCTTAC
ACTCCTCAATCTAATGGAATTGCGAAAAGGAAAAACCAAACTTTAAAGAAAATGATGAATGTCTTACATATAAACTCAGGCTTACCACAAAACTTAATAG
GATATGAAAAATAAAAAGGTAGAAAACCTAACTTGAAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.918059
Expected error %
0.354228
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89775.1| Score 150 E Value 8e-38 Identity 63.00% Align. Length 690bp (93.50%) Frame 1
pol polyprotein-like [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38766.1| Score 141 E Value 2e-32 Identity 61.30% Align. Length 726bp (98.37%) Frame 1
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0122P10
Clone
Clone name
hba-122p10
LE_HBa0122P10
P122P10
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found