Clone Read LE_HBa0123A10_SP6_58002

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0123A10_SP6_58002
Primer
SP6
ID from Seq. Facility
LE_HBa_123_A10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
659 trimmed for vector and quality, 909 raw
Genbank Accession
Sequence
>LE_HBa0123A10_SP6_58002 (raw untrimmed)
ACCAGTTTTTTGAAAGAACTATGGTAACCTATTGAAGAAAGTAGTTGCAAAGAATAAAATATACTGGCATGAGACCGTTGGTGAAGCTTTGTGGGCATAT
CGTACAACATTTAGAATGGCTACATCAACATTCCATTTTCCTTGCTTTATGGCGTAGAAGCTGTCCTGTCATTGGAGAAGCAAATTACATCATTGCGAAT
AGAAGTCCAAGAGGGACTTACAACTGAAAGCAACGTTCAACTTCGTCTAGCAGAGTTGGAGGCATTTGATGAAAAGAGATTGGAAGCACAACAAAAGTTG
GAATGTTATTAAGCTAAACTTGCAATAGCATTCAACAAGAAAGTGTGACCTCGATCATTTCAAGTGGGAGACTTTGTCTTAGCTGTAGGAAGACCCATAA
TCCTCAACAAATGCATTTGTGACAAGTTTACATCAAAATGGGATGGACCATGTGTTGTGAAGGAAGAATATTCAAGTGGCGCTTATAAAATTGTCGACCA
AGATGGTGTAAGAGTTGGTCCAATCAATGCCAAATTCCTCAAGCAATACTTCCCATGAAGGTTGGCTACGCTCCTTAAGTATGAGCATAAACTGCATGTT
ACTCCTGGTCCGCAAGAGTATAAACTGTGTACGACTCCCACAAAAAACACTCATCCTCTTGAACTACGATATGACTTGATCCTCTTTACCGAGGTACGTG
GGCGCTTGGAGTATTCCCTCTTGATTCCGTTTCATGAGCAAAAAAAAAGGAGTTGGTGGTCCTGCGTGACTCTCACCCATCTTTTTTTACAAAAAATCAG
GTAGGAACAATTATTTCTAAGCGGAGCAAATCGACTAATCTCTTTGGGTCATGAATTTTCAATAAGAAATTCATAACTGAAAATTTATTTCCATTCACAA
CTAATTAAT
>LE_HBa0123A10_SP6_58002 (trimmed for quality and cloning vector)
CCTATTGAAGAAAGTAGTTGCAAAGAATAAAATATACTGGCATGAGACCGTTGGTGAAGCTTTGTGGGCATATCGTACAACATTTAGAATGGCTACATCA
ACATTCCATTTTCCTTGCTTTATGGCGTAGAAGCTGTCCTGTCATTGGAGAAGCAAATTACATCATTGCGAATAGAAGTCCAAGAGGGACTTACAACTGA
AAGCAACGTTCAACTTCGTCTAGCAGAGTTGGAGGCATTTGATGAAAAGAGATTGGAAGCACAACAAAAGTTGGAATGTTATTAAGCTAAACTTGCAATA
GCATTCAACAAGAAAGTGTGACCTCGATCATTTCAAGTGGGAGACTTTGTCTTAGCTGTAGGAAGACCCATAATCCTCAACAAATGCATTTGTGACAAGT
TTACATCAAAATGGGATGGACCATGTGTTGTGAAGGAAGAATATTCAAGTGGCGCTTATAAAATTGTCGACCAAGATGGTGTAAGAGTTGGTCCAATCAA
TGCCAAATTCCTCAAGCAATACTTCCCATGAAGGTTGGCTACGCTCCTTAAGTATGAGCATAAACTGCATGTTACTCCTGGTCCGCAAGAGTATAAACTG
TGTACGACTCCCACAAAAAACACTCATCCTCTTGAACTACGATATGACTTGATCCTCTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.973006
Expected error %
0.195725
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_493776.1| Score 124 E Value 7e-33 Identity 44.30% Align. Length 523bp (79.36%) Frame 3
unnamed protein product [Oryza sativa (japonica cultivar-group)] dbj|BAB08213.2| Similar to Arabidopsis thaliana chromosome II BAC F26H6; putative retroelement pol polyprotein (AC006920) [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAD41628.3| Score 94 E Value 2e-18 Identity 12.90% Align. Length 371bp (56.30%) Frame 2
OSJNBa0091D06.8 [Oryza sativa (japonica cultivar-group)] ref|XP_473330.1| OSJNBa0091D06.8 [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0123A10
Clone
Clone name
hba-123a10
LE_HBa0123A10
P123A10
Clone type
BAC
Contamination
none
Estimated length
287,185
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found