Clone Read LE_HBa0123A10_T7_58003

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0123A10_T7_58003
Primer
T7
ID from Seq. Facility
LE_HBa_123_A10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
741 trimmed for vector and quality, 929 raw
Genbank Accession
Sequence
>LE_HBa0123A10_T7_58003 (raw untrimmed)
AAATAGCTCGGTACCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAACGCTCCAAATCCATATCATCGTTCCAATGGTAGTACTGTTGGCA
ACGGTGAGTCCCTTAATATTTTCTCACACTAGCACGGGTACCATTAAAACCCCCACCGCTATCTTTCACCTAGGTAATCTTACCCACGTCCCTTCTATTA
AAACCAATCTCCTTTTAGTTCACCAATTCACAAAAGACAATAATTGCTCACTCTTGTTCACCTCTAATGATTTCCAGATCCTAGACAATTCTAACAAGAT
GATGATTTTTAAGTGCCCCTTTGAGCATGGTCTGTACGTTCTTCCTGGCACAAGTTCGTCGGCCCACCCAGTTTCAGAAAACGTTCCTGTGGCTTCGGTG
GCTCTTTCGGCTGATGGCCACAGTCTGTTGTGGCATAGTCGTCTGGGTCACCCATCTACTCAAATAATAAATTCTTTAATGTCTCAATTAGGTTTTTCTT
CCATTCATGTAAACAATTGTGACTCCTGTTCAATTGCTCAATCTCATAAATTACCTTTTACTTTATCTGAGAAGCGTACAACTGCACCTTTTCAACTTAT
TCATTTTGACCTATGGGGTCCTACTGATGTTCCTTCATTTGCTAGTTTTCGCTATTATATTTGTTTTGTGGATGATTTTACAAAATACACTTGGTTGTAC
CCCACTAAAACACAAAATCACAGGCATACCCCACCTTTGTCACTTTTTGAAAAAAGGGAAAAACCCATTCAATTCTCATTTAAACTTTTTCTAAGTGACA
TGGAAAAGAATAGTCAATAACACCTTGGCAAGTTCTGCAATCCCTGGGAATTAAACCCAAACCTTCCGTCCCTCCCCTCCCAAAAGAAGGGGGTGGTGAA
CGAACCCTTCCCTTTCTTTTGAACGGTGT
>LE_HBa0123A10_T7_58003 (trimmed for quality and cloning vector)
AGCTTAACGCTCCAAATCCATATCATCGTTCCAATGGTAGTACTGTTGGCAACGGTGAGTCCCTTAATATTTTCTCACACTAGCACGGGTACCATTAAAA
CCCCCACCGCTATCTTTCACCTAGGTAATCTTACCCACGTCCCTTCTATTAAAACCAATCTCCTTTTAGTTCACCAATTCACAAAAGACAATAATTGCTC
ACTCTTGTTCACCTCTAATGATTTCCAGATCCTAGACAATTCTAACAAGATGATGATTTTTAAGTGCCCCTTTGAGCATGGTCTGTACGTTCTTCCTGGC
ACAAGTTCGTCGGCCCACCCAGTTTCAGAAAACGTTCCTGTGGCTTCGGTGGCTCTTTCGGCTGATGGCCACAGTCTGTTGTGGCATAGTCGTCTGGGTC
ACCCATCTACTCAAATAATAAATTCTTTAATGTCTCAATTAGGTTTTTCTTCCATTCATGTAAACAATTGTGACTCCTGTTCAATTGCTCAATCTCATAA
ATTACCTTTTACTTTATCTGAGAAGCGTACAACTGCACCTTTTCAACTTATTCATTTTGACCTATGGGGTCCTACTGATGTTCCTTCATTTGCTAGTTTT
CGCTATTATATTTGTTTTGTGGATGATTTTACAAAATACACTTGGTTGTACCCCACTAAAACACAAAATCACAGGCATACCCCACCTTTGTCACTTTTTG
AAAAAAGGGAAAAACCCATTCAATTCTCATTTAAACTTTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.95373
Expected error %
1.01058
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_915573.1| Score 136 E Value 5e-31 Identity 11.70% Align. Length 587bp (79.22%) Frame 2
putative gag/pol polyprotein [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU10682.1| Score 132 E Value 7e-30 Identity 12.20% Align. Length 620bp (83.67%) Frame 2
putative polyprotein [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0123A10
Clone
Clone name
hba-123a10
LE_HBa0123A10
P123A10
Clone type
BAC
Contamination
none
Estimated length
287,185
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found