Clone Read LE_HBa0123D19_SP6_58164

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0123D19_SP6_58164
Primer
SP6
ID from Seq. Facility
LE_HBa_123_D19-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
606 trimmed for vector and quality, 919 raw
Genbank Accession
Sequence
>LE_HBa0123D19_SP6_58164 (raw untrimmed)
CATAAATTTCCTTTGTTTACTTAAAGGTTAATAAAGGGTTGGGACTGGTTCCTGTAAATTCTGGTGGTTGTTTCCCTTTAGTGTTTTAAGTATTTCTACA
CTTAGTCAATTTTCCCGTGTGCAAGTAGGCTGAGTGTTACAGACGTTTGTAAGACTGCCTAGAGTGGTGTGCGATAAAAATAATCGACCCTCTTTCAATT
GGTATCAGAGCGCGGTTAAACAATGGTGAAAAATGTAGAACTATGGGAGTTGGCATGAAAAATTGAATCCTTCGTTGGGTTTACTGAAGACATTTTGGGA
GACCCTACGTTTGTGGATTTATTCACACAAATCATTGAGTTGAGAGTGGATGCTAAGAAATTTCAGGGAGAAATTGGTGGATATCGACAGAATGTTGATA
ATCACATTACTGAAATCTTGGACTTTCGTACCACAACTACGCAAAAACTGGAGGGACTACAGAAGGAAAATGAGAACCTTCGTGCAGAACTCATCGTTTT
GTGCCGGGCTGTGGCCACATTAAGTTCAACTCGTGTTGAATCGTCTAAGGTAAAGATTTCAGAACCTAAGTCCTTTAGTGGCGTAAGGAGTGCTAAAGAA
CTGGAAAATTTCATCTGGGACATGGAGCAGTATTTTACCCCTGCAAGGGTGTCGGACGCCGATAAGTTGAACTTTACCACAATGTATTTGTCGGGTGAAT
CCAGAACTTTGGTGGACGACTCGAAATGCCGAACAAGTAAAGTGCTGGTCGTCCTAGTATTGTGTCATGGGATAAACCTAATTAAAAAAAGGGGTGATTA
TATCCGTCCGAGTCAATGCACTCTGGCTTGAACACATAACATTTAAAAAGTGCTAATGTTTCCATAGACTGTAGATGAAAATATTCAAAATTATTTCAAT
TAAAAATAAAAAAAAAAAA
>LE_HBa0123D19_SP6_58164 (trimmed for quality and cloning vector)
TTAAAGGTTAATAAAGGGTTGGGACTGGTTCCTGTAAATTCTGGTGGTTGTTTCCCTTTAGTGTTTTAAGTATTTCTACACTTAGTCAATTTTCCCGTGT
GCAAGTAGGCTGAGTGTTACAGACGTTTGTAAGACTGCCTAGAGTGGTGTGCGATAAAAATAATCGACCCTCTTTCAATTGGTATCAGAGCGCGGTTAAA
CAATGGTGAAAAATGTAGAACTATGGGAGTTGGCATGAAAAATTGAATCCTTCGTTGGGTTTACTGAAGACATTTTGGGAGACCCTACGTTTGTGGATTT
ATTCACACAAATCATTGAGTTGAGAGTGGATGCTAAGAAATTTCAGGGAGAAATTGGTGGATATCGACAGAATGTTGATAATCACATTACTGAAATCTTG
GACTTTCGTACCACAACTACGCAAAAACTGGAGGGACTACAGAAGGAAAATGAGAACCTTCGTGCAGAACTCATCGTTTTGTGCCGGGCTGTGGCCACAT
TAAGTTCAACTCGTGTTGAATCGTCTAAGGTAAAGATTTCAGAACCTAAGTCCTTTAGTGGCGTAAGGAGTGCTAAAGAACTGGAAAATTTCATCTGGGA
CATGGA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.968034
Expected error %
0.467232
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAD13304.1| Score 244 E Value 1e-63 Identity 30.30% Align. Length 401bp (66.17%) Frame 3
polyprotein [Lycopersicon esculentum] pir||T17459 polyprotein - tomato
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU90321.1| Score 98 E Value 1e-19 Identity 14.00% Align. Length 419bp (69.14%) Frame 3
hypothetical protein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0123D19
Clone
Clone name
hba-123d19
LE_HBa0123D19
C03HBa0123D19
P123D19
Clone type
BAC
Contamination
none
Estimated length
72,261
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found