Clone Read LE_HBa0123D19_T7_58165

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0123D19_T7_58165
Primer
T7
ID from Seq. Facility
LE_HBa_123_D19-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
745 trimmed for vector and quality, 929 raw
Genbank Accession
Sequence
>LE_HBa0123D19_T7_58165 (raw untrimmed)
ACCCAACCTGGTCCCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATGCTTTTATAAGTCAGTATCCTTTTGGGCCACCAAGAAAATATAA
ACGGAAATGTTTCTGTCCCTTTGAGAATAGGAATAAGAAATTACGTGAAATCCTACTTGGATAAGGATTGTAATGTAGAGTCTATAAACAGGGCCGCAAT
AATGCAGATACAAGTTAAATGATATTTTTCTCTTATACTTTTCACATGGTATCAAAGCATTGGTGAGAAACATCTGGTGAAGGAAAATCAGGTCAAAATT
GCCGCCATGCATCAAATTCTGGCAACTTTCTAGGGCTGTTGGTAAATTTCAGAAGTACAAGATATTAGATAGTAGAGAAGTCAAGAAGAATATCAGCAGA
AGAACTTTTTATTGATGTCTCACCATTACATCTGTTAGACTGGAGTGAAATAAAAAGTATTAAACACGGCTAGGAGATTCCCTAAAGCACTAACTAACTC
CTAAATAATAAGAATACATGGCTAACAACTAATTGACTAAGTCTTATATAATATAAAGCAGTAAACATAAATTATCTGCAGTTCAAAAGAAAATTCCTAA
CACTCCTCCTTGCTTTGGAAACTGCAAACTCCAAATCTGTCTGAGGAGCTCAAACTTACTGACTGGTAAATGTTTAGTCAATGTATCACCCAATTGTTCT
TCCGTCTTGCAGTAGAGAAAAATTATATCTCTTATCTTTTTGCACTTCCCTCAAGAAGAACAACTTGATTTTGAAGTGGCTTAGTTCATTGTGAAGAAAA
GCCTATTGTTCGCCCCTTGGCCACAAGCCATTCAATGGCTCCAGCTGGCTTCATATGCAGATCAATCGGAATTTTCCTCCGCTCCACTGGCTGTTTTATG
TTGCCTGCGTGCTACTAACTTTCTTCTGA
>LE_HBa0123D19_T7_58165 (trimmed for quality and cloning vector)
AGCTTATGCTTTTATAAGTCAGTATCCTTTTGGGCCACCAAGAAAATATAAACGGAAATGTTTCTGTCCCTTTGAGAATAGGAATAAGAAATTACGTGAA
ATCCTACTTGGATAAGGATTGTAATGTAGAGTCTATAAACAGGGCCGCAATAATGCAGATACAAGTTAAATGATATTTTTCTCTTATACTTTTCACATGG
TATCAAAGCATTGGTGAGAAACATCTGGTGAAGGAAAATCAGGTCAAAATTGCCGCCATGCATCAAATTCTGGCAACTTTCTAGGGCTGTTGGTAAATTT
CAGAAGTACAAGATATTAGATAGTAGAGAAGTCAAGAAGAATATCAGCAGAAGAACTTTTTATTGATGTCTCACCATTACATCTGTTAGACTGGAGTGAA
ATAAAAAGTATTAAACACGGCTAGGAGATTCCCTAAAGCACTAACTAACTCCTAAATAATAAGAATACATGGCTAACAACTAATTGACTAAGTCTTATAT
AATATAAAGCAGTAAACATAAATTATCTGCAGTTCAAAAGAAAATTCCTAACACTCCTCCTTGCTTTGGAAACTGCAAACTCCAAATCTGTCTGAGGAGC
TCAAACTTACTGACTGGTAAATGTTTAGTCAATGTATCACCCAATTGTTCTTCCGTCTTGCAGTAGAGAAAAATTATATCTCTTATCTTTTTGCACTTCC
CTCAAGAAGAACAACTTGATTTTGAAGTGGCTTAGTTCATTGTGA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.948429
Expected error %
1.2224
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0123D19
Clone
Clone name
hba-123d19
LE_HBa0123D19
C03HBa0123D19
P123D19
Clone type
BAC
Contamination
none
Estimated length
72,261
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found