Clone Read LE_HBa0123G24_T7_58319

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0123G24_T7_58319
Primer
T7
ID from Seq. Facility
LE_HBa_123_G24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
695 trimmed for vector and quality, 902 raw
Sequence
>LE_HBa0123G24_T7_58319 (raw untrimmed)
AGCCTGGCTGGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTCCGCATTCACTATTTTTGCCATTTAAAAAATTATGATCATCAA
GTTTAATTTTGATACTTCCCTCTACTAATTTAACATTTTTATTTACGCATCACTTTCTTATTCCAAAAGTGGTTCATTTATTCCCGTCCTCCTCCGCTCC
CGCACGTCATAAGTGGCTTTCTATATAATTTTATTTTCTCAACAATTTCATTCTGCCCATTCCCGGTCCGATCTCTGCCTTTGGTTTTTTTTCTGCATTT
ATCTATACTTGATGAAAATATGATTTCCTTTCCGTCTCAAAACATACTCAATATTCTAGTTACTTGATGTAATATTCAGCACTGTAAGGAAAGGGATACC
TGTTCATATAAGTGACTGTGCTCATCTGACAGCAAACAATACACATCCTTATACTCCCATTCATTTACTTAAAAGCTCATGCCCGACCTCCCTCTGGATA
TGAACTCGGACAAACACAGTTATTGCATTAGCCCATCTTGAACGTTTTGCCTTTAACTCTCTTAACTCTACAGGAGCCATTCTATAAGGGGGTATAGAAA
TGGGGCGAGTACCCGGTTCAAGATCGATGCAGAAGTCAATATCTCTATCCGTTGTCATACCAGGAAGGTTTGCAGCAAACACATCTAAAAATTCGCGGAC
TATCGAAACCGACTCAATTGAAGGTACTTGGGTAGTGTCATCACTGAAAAGGGCCAAGAAAGCTAGAAAACCCTTACTAACTATTTTCTAACCCAAAGAA
GGAAAAAATAGAAACAGGATAGGAAAGGTAGTCCCTCTCCACTATTAATGAACTGTCCATATTTGCTATGGCAACGTTTTGGCTTAGAGTCAGGAGGTGA
AG
>LE_HBa0123G24_T7_58319 (trimmed for quality and cloning vector)
AGCTTCTCCGCATTCACTATTTTTGCCATTTAAAAAATTATGATCATCAAGTTTAATTTTGATACTTCCCTCTACTAATTTAACATTTTTATTTACGCAT
CACTTTCTTATTCCAAAAGTGGTTCATTTATTCCCGTCCTCCTCCGCTCCCGCACGTCATAAGTGGCTTTCTATATAATTTTATTTTCTCAACAATTTCA
TTCTGCCCATTCCCGGTCCGATCTCTGCCTTTGGTTTTTTTTCTGCATTTATCTATACTTGATGAAAATATGATTTCCTTTCCGTCTCAAAACATACTCA
ATATTCTAGTTACTTGATGTAATATTCAGCACTGTAAGGAAAGGGATACCTGTTCATATAAGTGACTGTGCTCATCTGACAGCAAACAATACACATCCTT
ATACTCCCATTCATTTACTTAAAAGCTCATGCCCGACCTCCCTCTGGATATGAACTCGGACAAACACAGTTATTGCATTAGCCCATCTTGAACGTTTTGC
CTTTAACTCTCTTAACTCTACAGGAGCCATTCTATAAGGGGGTATAGAAATGGGGCGAGTACCCGGTTCAAGATCGATGCAGAAGTCAATATCTCTATCC
GTTGTCATACCAGGAAGGTTTGCAGCAAACACATCTAAAAATTCGCGGACTATCGAAACCGACTCAATTGAAGGTACTTGGGTAGTGTCATCACT

This is probably not a useful sequence.

Problems:
  • High predicted error rate
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.961356
Expected error %
5.57445
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 94 E Value 7e-24 Identity 31.10% Align. Length 502bp (72.23%) Frame 2
putative polyprotein, 3'-partial [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 92 E Value 1e-23 Identity 31.10% Align. Length 481bp (69.21%) Frame 2
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0123G24
Clone
Clone name
hba-123g24
LE_HBa0123G24
P123G24
Clone type
BAC
Contamination
none
Estimated length
177,039
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found