Clone Read LE_HBa0123I07_SP6_58380

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0123I07_SP6_58380
Primer
SP6
ID from Seq. Facility
LE_HBa_123_I07-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
611 trimmed for vector and quality, 957 raw
Sequence
>LE_HBa0123I07_SP6_58380 (raw untrimmed)
AAAACATATGCGAAAGGGAAAGGAAAATCGTTGAAGATTGGTGACACGAGTTCGACATTTAAGATATGTTAAGACTTTTTAGACTTGTTGAAAGACGTTT
TCCTAATTAAAGAAGAAAAAAAGTAAAATGAAATAGACAATGGGTAAGGGCGAAAGATGGGGGTCTCATATCAATGGTGTGACGGGCATTGGTACGAGTA
CCGGTGTTATAAAAGGGAAAGTTACTACTATAGAATGTGGATTGTAATTTGAAAATGCCAAAGCATATGGGCATTAGCTGATGTATTATTGACTTGAAAT
CTTTGTGTGATTGTGTTTTCTTTGTTACACCCGTATAGTTGTGATTATTGAGGTGATTATGTATTATGTTGATACTTGATTGAATGAGGTGCATCATCAT
CCCCGTATTTGAAATAATAGTGTACATGCATTGACATGAGATTGAGTATAAGTTGGGCACGTGGAGATCATCCGTGCTGGGATGGTGAGATGTTAAGATC
GTAATTTGGGCACGCAGAGACTGTCCGTGCGGAAATTGTTAATTTTATCATTGTGCATTGAGATCGTCCGCACAGACACGTGGAGATTGTCCGTGTCGGT
ATATGGACCTCGCGAGTCCCCCATGGGTCATGAACTCTCGATGTACTTCCGAGGAGTATCATGTTTATACCGTTGAGGAAGTATTGTATTTTCTGAGATA
TATTATTTCATGGCCACCTAATTGCTATGCATCTCATCACTATCCTTCCTTCTAGAAGGATTAGGGGTTTGATTCGACGGCAATCAATCTTCTCATGTTT
ACATCCCCCTACATGAAAAAAACACGACAGGCAGACATACTTCCACGTGATAAACAAAACACAATCTCTTCTCTAAAACACTCTACCCCCTCCAACACAC
TGTTGTACATGAAACACAAGCCGACCTCGATTCCAATCAACTATATATTTTAATATA
>LE_HBa0123I07_SP6_58380 (trimmed for quality and cloning vector)
ATTGGTGACACGAGTTCGACATTTAAGATATGTTAAGACTTTTTAGACTTGTTGAAAGACGTTTTCCTAATTAAAGAAGAAAAAAAGTAAAATGAAATAG
ACAATGGGTAAGGGCGAAAGATGGGGGTCTCATATCAATGGTGTGACGGGCATTGGTACGAGTACCGGTGTTATAAAAGGGAAAGTTACTACTATAGAAT
GTGGATTGTAATTTGAAAATGCCAAAGCATATGGGCATTAGCTGATGTATTATTGACTTGAAATCTTTGTGTGATTGTGTTTTCTTTGTTACACCCGTAT
AGTTGTGATTATTGAGGTGATTATGTATTATGTTGATACTTGATTGAATGAGGTGCATCATCATCCCCGTATTTGAAATAATAGTGTACATGCATTGACA
TGAGATTGAGTATAAGTTGGGCACGTGGAGATCATCCGTGCTGGGATGGTGAGATGTTAAGATCGTAATTTGGGCACGCAGAGACTGTCCGTGCGGAAAT
TGTTAATTTTATCATTGTGCATTGAGATCGTCCGCACAGACACGTGGAGATTGTCCGTGTCGGTATATGGACCTCGCGAGTCCCCCATGGGTCATGAACT
CTCGATGTACT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.960397
Expected error %
0.0372812
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0123I07
Clone
Clone name
hba-123i7
LE_HBa0123I07
P123I07
Clone type
BAC
Contamination
none
Estimated length
61,096
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found