Clone Read LE_HBa0123I07_T7_58381

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0123I07_T7_58381
Primer
T7
ID from Seq. Facility
LE_HBa_123_I07-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
533 trimmed for vector and quality, 944 raw
Sequence
>LE_HBa0123I07_T7_58381 (raw untrimmed)
ATAAATCGGGTCCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGCTCAAGAAAAGAAAGACTGCCATATTCTTCTTGAAGCAATTCAAATT
GAGGTCGGCTTACTTCCAGAAGATTTAGAGGAAATAAAAATGCAACTGAATAACATCAAAAAATCGCCCAGTCACAGTCCTGGTCAATCTAACCAAACTA
CTTTATATAGGAGAAACTCTCCTAATCACAGTTTCTACAAATCAAATAAATCTAGTTCTAATTCTTATTCACCTGAAACCTCCGTTAAAATTAACTGCTA
CACTTGTGGTGATCTTGGTCACAAATCTTTTAATTGTAGAAAATACACTTCTGGAAAATGGATTTGGAGACCAGAGACTTCTAACCATCAAGGATCCAAA
AATACTTGGATACCTAAAAGAAACTAATTTATTATTTTGTAGGAGCGGTCTAAGAAAACCTATAAAAAAAAGGAATGTGGGTACTTGCTAGTGGATGCTC
CATAAATATGTGCTGAAAGAAACAAAACTTTAAATGTTAAAAAAAGATTGATGGAGGATTTGTGAGATTTGGGGACAATGTTGAAGGAGAAGTATCAGGA
GTTCTAACCTATTGTCATACATCTTCAAGCTATCTGAGAGAAACTTCCTTGTGTATTATCTCGAGAAAAAGATTTCACCCATTTGGAGTTGAGTAAGAAT
TCATGTGTTCACTACTATATGAATCTATCTACATTGTTAATTCTGCTGCACCCTCTTTGATCTTTTATTATTTCTTTTATCAATACAAATAAATATCTAT
ATTTCTGATCGTCACCTGAGCATTTTTCTACATATACCATAAATTCTTTTCATTTTAACTTTTTTTGCCATATCTGTTCTACGGTATTCCTTTTTTGTAT
GCCCTGTACGTCCGTCTTCTCAGTTACTACTATCGTTGAATCTT
>LE_HBa0123I07_T7_58381 (trimmed for quality and cloning vector)
AGCTTGCTCAAGAAAAGAAAGACTGCCATATTCTTCTTGAAGCAATTCAAATTGAGGTCGGCTTACTTCCAGAAGATTTAGAGGAAATAAAAATGCAACT
GAATAACATCAAAAAATCGCCCAGTCACAGTCCTGGTCAATCTAACCAAACTACTTTATATAGGAGAAACTCTCCTAATCACAGTTTCTACAAATCAAAT
AAATCTAGTTCTAATTCTTATTCACCTGAAACCTCCGTTAAAATTAACTGCTACACTTGTGGTGATCTTGGTCACAAATCTTTTAATTGTAGAAAATACA
CTTCTGGAAAATGGATTTGGAGACCAGAGACTTCTAACCATCAAGGATCCAAAAATACTTGGATACCTAAAAGAAACTAATTTATTATTTTGTAGGAGCG
GTCTAAGAAAACCTATAAAAAAAAGGAATGTGGGTACTTGCTAGTGGATGCTCCATAAATATGTGCTGAAAGAAACAAAACTTTAAATGTTAAAAAAAGA
TTGATGGAGGATTTGTGAGATTTGGGGACAATG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.932532
Expected error %
0.191492
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0123I07
Clone
Clone name
hba-123i7
LE_HBa0123I07
P123I07
Clone type
BAC
Contamination
none
Estimated length
61,096
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found