Clone Read LE_HBa0123M01_SP6_58560

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0123M01_SP6_58560
Primer
SP6
ID from Seq. Facility
LE_HBa_123_M01-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
769 trimmed for vector and quality, 879 raw
Sequence
>LE_HBa0123M01_SP6_58560 (raw untrimmed)
GGCGGGATTTCCTTTCAGGAGGGAGATAATTGTTGAATCAAATTGATATATCCTTACTTCCTAACAGTACAAGCACTGGAGCTAGGGATTGTACATGAAT
AAAGGGGTAACATACCTACCATCACTCTTCACCTTAACCTCAACACTCCTTCCCATTCCAAATTTACCAGTCCTTTAATTTGAAGACTTTCTCTACTATA
AAATTCAAGGAAGATACAACAACAACAAGTGTAATTGTAACTCCACGAGTCGGGTTTGAGGAGGTTAGAGTGTACCTAAGGTAAAAAGTTTATTTTCGAT
AAACCTTTGCGAAACCAAAAAAACAAATAAGTAAAACAAATACAGTAGCGAAGAAGTCATGCTAAAAACAATTAAGAAAAGAACAAGTTGAAGGAAAATG
TTAGGCCTTATTACCCTGGTTGTGTAACTGCAGTTGACCAGAAGATTGCATAGCTCCATTGAATGCCTCTAACAGCAAGAGCAAGTTGCTTTCTCAAGTT
GCCTGGGACTCCATCTTGATCTTGGTGTCCCATAGCCATTTTCAAAGCTTCAATCTTTTGTCTCACCAAAATGACAGTGAAGAAAAAATCAGCTCAAAAT
TCTAAAAAACGACACCAAAATCATAAAACACCAAGAAAGCATAAATCTTGAATCTTGATCCCAAATGGGATCTTAGTTCTCAGGACCACAACCATATTGG
ACCATACAAAGAGAATTTTTTAGTTTCAGATTTCAAGAAACAAGGCCAAAACAGCCATTTTTTCACAAGGATAATGTTAATGACTAAGTAGTAAGCACCC
TTTTGAGCTAAAATCATAAAGATAGAGACTTGCTACAACTTGGCATATATCCATAAATCCCCATAAGTGAAATGTACAG
>LE_HBa0123M01_SP6_58560 (trimmed for quality and cloning vector)
TCAAATTGATATATCCTTACTTCCTAACAGTACAAGCACTGGAGCTAGGGATTGTACATGAATAAAGGGGTAACATACCTACCATCACTCTTCACCTTAA
CCTCAACACTCCTTCCCATTCCAAATTTACCAGTCCTTTAATTTGAAGACTTTCTCTACTATAAAATTCAAGGAAGATACAACAACAACAAGTGTAATTG
TAACTCCACGAGTCGGGTTTGAGGAGGTTAGAGTGTACCTAAGGTAAAAAGTTTATTTTCGATAAACCTTTGCGAAACCAAAAAAACAAATAAGTAAAAC
AAATACAGTAGCGAAGAAGTCATGCTAAAAACAATTAAGAAAAGAACAAGTTGAAGGAAAATGTTAGGCCTTATTACCCTGGTTGTGTAACTGCAGTTGA
CCAGAAGATTGCATAGCTCCATTGAATGCCTCTAACAGCAAGAGCAAGTTGCTTTCTCAAGTTGCCTGGGACTCCATCTTGATCTTGGTGTCCCATAGCC
ATTTTCAAAGCTTCAATCTTTTGTCTCACCAAAATGACAGTGAAGAAAAAATCAGCTCAAAATTCTAAAAAACGACACCAAAATCATAAAACACCAAGAA
AGCATAAATCTTGAATCTTGATCCCAAATGGGATCTTAGTTCTCAGGACCACAACCATATTGGACCATACAAAGAGAATTTTTTAGTTTCAGATTTCAAG
AAACAAGGCCAAAACAGCCATTTTTTCACAAGGATAATGTTAATGACTAAGTAGTAAGCACCCTTTTGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.945227
Expected error %
0.519313
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC39455.1| Score 70 E Value 5e-11 Identity 25.40% Align. Length 125bp (16.25%) Frame 3
bHLH transcription factor JAF13 [Petunia x hybrida]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0123M01
Clone
Clone name
hba-123m1
LE_HBa0123M01
C08HBa0123M01
P123M01
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found