Clone Read LE_HBa0123M01_T7_58561

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0123M01_T7_58561
Primer
T7
ID from Seq. Facility
LE_HBa_123_M01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
825 trimmed for vector and quality, 874 raw
Sequence
>LE_HBa0123M01_T7_58561 (raw untrimmed)
ATTAACCTGGGTCCCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTTTTATGAAATCAAATCTCCCGTAAGGTCTCTGAAATTATGTTAA
TGAATGCAGATTGGACGTATGAAGAAGAAGAAGTATATTCAAGTATTCTGGAAGATTCCCAGAACTGAAAGCTACAGGAAAATTGAAAAACAGAACTAAC
TACATTTCTCTACCTTCCAATCTATATATATACATACATATATAAAGAATATAATAATAACTTTAACTAACTCCTAACTAATTTATTACTAATTACAAAT
ATACCCTCTTATTCAAGTAATGCCTTCTTTAATACTCCCCTCAAGTTTGAAGGCATGAACAAGTTCATTACTCCAAACTTGGATAACAAGTATTCATGTT
GAGATTTTCCTAATCCTTTAGTTAGCATATCAGCTTCTTGCTCCTTTGTATGTAGATACTTTGTTTCGAGTAATCCTTGCTGAATCTTCTCACGTATGAA
ATGACAATCCTACTCAATGTGTTTTGTTCTTTCATGTAACACTGGATTAGCAGCAATTTGTATGCTGATTTACTGTCACTGTAAACACTGACTGGAGTTT
GAATCTTAGCTCCCAATTCTTTAAACAACTTAACTATCCATGTAATCTCAGCTATAGCACTGGCCATACTTCTATACTCAGCTTCAGGTGAGCTTCTAGA
GACTGTGGCTTGTTTCTTTGATTTCCAATAGATCAATGATTCTCACATCTTCACCATAAAACCTGAAACTGATGTATTCTAGTGTGTAAACAAGCTTCCC
AATCTGCATCACAGTAAACCTTTAACTGTTTGGGACTTTTACTAGACAGGAGAACTCCTTGTCCGGCTTGATTT
>LE_HBa0123M01_T7_58561 (trimmed for quality and cloning vector)
AGCTTGTTTTATGAAATCAAATCTCCCGTAAGGTCTCTGAAATTATGTTAATGAATGCAGATTGGACGTATGAAGAAGAAGAAGTATATTCAAGTATTCT
GGAAGATTCCCAGAACTGAAAGCTACAGGAAAATTGAAAAACAGAACTAACTACATTTCTCTACCTTCCAATCTATATATATACATACATATATAAAGAA
TATAATAATAACTTTAACTAACTCCTAACTAATTTATTACTAATTACAAATATACCCTCTTATTCAAGTAATGCCTTCTTTAATACTCCCCTCAAGTTTG
AAGGCATGAACAAGTTCATTACTCCAAACTTGGATAACAAGTATTCATGTTGAGATTTTCCTAATCCTTTAGTTAGCATATCAGCTTCTTGCTCCTTTGT
ATGTAGATACTTTGTTTCGAGTAATCCTTGCTGAATCTTCTCACGTATGAAATGACAATCCTACTCAATGTGTTTTGTTCTTTCATGTAACACTGGATTA
GCAGCAATTTGTATGCTGATTTACTGTCACTGTAAACACTGACTGGAGTTTGAATCTTAGCTCCCAATTCTTTAAACAACTTAACTATCCATGTAATCTC
AGCTATAGCACTGGCCATACTTCTATACTCAGCTTCAGGTGAGCTTCTAGAGACTGTGGCTTGTTTCTTTGATTTCCAATAGATCAATGATTCTCACATC
TTCACCATAAAACCTGAAACTGATGTATTCTAGTGTGTAAACAAGCTTCCCAATCTGCATCACAGTAAACCTTTAACTGTTTGGGACTTTTACTAGACAG
GAGAACTCCTTGTCCGGCTTGATTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.943453
Expected error %
0.934584
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23160.1 Score 62 E Value 1e-20 Identity 41.40% Align. Length 504bp (61.09%) Frame 3
68417.m03342 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89728.1| Score 104 E Value 2e-45 Identity 64.40% Align. Length 528bp (64.00%) Frame 3
putative retroelement pol polyprotein-like [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAD19784.1| Score 86 E Value 1e-37 Identity 54.30% Align. Length 516bp (62.55%) Frame 3
putative retroelement pol polyprotein [Arabidopsis thaliana] pir||C84512 probable retroelement pol polyprotein [imported] - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0123M01
Clone
Clone name
hba-123m1
LE_HBa0123M01
C08HBa0123M01
P123M01
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found