Clone Read LE_HBa0123N09_SP6_58624

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0123N09_SP6_58624
Primer
SP6
ID from Seq. Facility
LE_HBa_123_N09-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
3 trimmed for vector and quality, 905 raw
Sequence
>LE_HBa0123N09_SP6_58624 (raw untrimmed)
TGACAATGCTACTCCGAAATCTATCGGCCCCCTCTATCCGACGATCACACTCTCCACAAACAGCAGCGATGCGAGAAGAGCTTGACATCAGCACTACAAA
AGACAATCATCAAAAGAGTGCTATTACTGAAGGGCGACGCTGAAATCTTGAATTGGAAAAAAGCATATACGATGTGCACACATCGACAACACGAAGAAAC
AGTAATGATGTGATTACATTGAGGAATATATAACTACGCATCTTAATTGATAGAACTGTAATGTAGATACAACTCGCTCCTTACCATTATGGTAATAGTA
TATATTGTGCGCGACTTCATATTGGAAGGCGCTTGTCATGGGTATCTCTGTGAGCGACAGACATTAGACACGTAAAATTATGGGTTATCGCCAACAGGGG
CTGGGAATAGGTGAGTTCTGTAGACAGAGTATCCTTGCAATACATGATACGACTCATCACTGATATAAACTATCGAGTACCATCGATTCTGTACTCTAGG
GAGAGGAAGGNGCGACACTTTCGCATA
ATTTTAGGCATGATTATTCATGTTCCGCTTAGCCGTAGACCAATCTGCTATGAAATTGCCATATCTGATCCTT
CTCACTTGCTGCATACTCTTTCGTAGATTCTGCTACTCATTGATATCCATCATCGTTACTATCTCGTCGATCTCGCTATAACTCTAATTTTATTCCAGAA
TGACTACTATGGTATATGTGTCATAATACATTGCTATGAGCAGGGTAAGCAAGTACGACCTAGGACCTCCTTATCGCATCGTGCGAAGCATACCAAGGTA
CGCAAAGAGCTCACTACAGGAACATGTNCTATACGATAATTATATCACGCTAACTAGCTAATGAAACTTGTTATGCATGAAAACTCTCAATTATTTCTGA
TTGAC
>LE_HBa0123N09_SP6_58624 (trimmed for quality and cloning vector)
ATT

This is probably not a useful sequence.

Problems:
  • Short cloning insert
  • High predicted error rate
  • Low complexity
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
5.63148
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0123N09
Clone
Clone name
hba-123n9
LE_HBa0123N09
C03HBa0123N09
P123N09
Clone type
BAC
Contamination
none
Estimated length
97,152
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found