Clone Read LE_HBa0124A03_SP6_58756

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0124A03_SP6_58756
Primer
SP6
ID from Seq. Facility
LE_HBa_124_A03-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
161 trimmed for vector and quality, 904 raw
Sequence
>LE_HBa0124A03_SP6_58756 (raw untrimmed)
AAGAAAATCCCGGGGGCAATGAATTTAGAGGGGTCGAGGGGAGGATTGACCCTTCATTTCAAAGGGCTATAAAATGCTTTTCCCGGCCTACCCCCCGAAG
GGTCAAGGGCTGGGGCCCGTTTACCCTATTTTTTATTGTTTTTTTATTTTACGTCCAATTAATCCCCCTTACACCATCTTTGTTTCTATCAAACAAATCC
AATCCAATCATCCATATTTAAAGAAACACATCATGATCGCTTAATGGAACCAGATATAAAATTTTCATCCATCCACCTCAATAACGCATTTCACTCCAAT
TATGGTGCACTCTACATACTTGCTGCAAGTGATTTCACTAAATAAAATCCAGCCCCTACTCCCGCCCACACCCTCTGACTCCAACCCCTTGCAGCTTCAA
TAAAGTTTACTACCTATGTCGTATGCCCTACAAAATATAATACAAACATTTCTGACGTCACCTTCTTATACCCTCGACAAACACTTATAACGT
ATCCAAC
ACCAATGTATCATATTTTTCGTCAAGACTATTTAAAGGCCTAACCCATCGGTGACCCCTTAAATTTGGCATGAAGTTTTAGTTAGACATCTTAACTGAAC
AATGTTTATTTAAGACACCTCGTGTACGGTATCACTGTGTCATTTTGACACTTTTTTTCTAATCAACCAAATATTTGAGATTTATTTTTTATTCTCTTGA
CAGGAATGCAAAGTGACAAATTATATGATGACATTTTCATTAGTGTCAAAACATATTCAAATACTAATTTTGTGTATAATATAACATTAACCAATTATAA
ATGACAAGTGAATTTTACCCCAAATATTTGTAAAGAAATATTGCCTTTATTCTCCCGTGTTCTTTTTTATTCTTTNTATTTATTATTTTATTTCTTATTC
TTTT
>LE_HBa0124A03_SP6_58756 (trimmed for quality and cloning vector)
ATCCAACACCAATGTATCATATTTTTCGTCAAGACTATTTAAAGGCCTAACCCATCGGTGACCCCTTAAATTTGGCATGAAGTTTTAGTTAGACATCTTA
ACTGAACAATGTTTATTTAAGACACCTCGTGTACGGTATCACTGTGTCATTTTGACACTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.947622
Expected error %
1.63384
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0124A03
Clone
Clone name
hba-124a3
LE_HBa0124A03
P124A03
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found