Clone Read LE_HBa0124M10_SP6_59346

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0124M10_SP6_59346
Primer
SP6
ID from Seq. Facility
LE_HBa_124_M10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
679 trimmed for vector and quality, 937 raw
Sequence
>LE_HBa0124M10_SP6_59346 (raw untrimmed)
CCCAGGTTTCTCTTACGTCAAGACCAATTCCATTATTAAGGATTACGGATAATGACCAGGATCATTGTGATCCCTTTAAGGGCAAAATTTGCTCTGAGAC
GTTTCCAGATGACCCTTTGCGTGGCACACACTGGATGGACAGCCACAAAAAGGAAGCCCAATGGCTTTTCAGGGGTTATGCTTGTGCTATCTGTCTGGAT
TCTTTTACTAATAAGAAAGTTTTGGAAACTCATGTGCAGGAAAGGCACCATTCACAGTTTGTTGAAAATTGCATGCTTTTTCAGTGTATTCCGTGTACTA
GCAATTTTGGGAACTCAGAGGAGTTATGGTCCCACGTGCTCACCGCACATCCTTCCAGTTTTAGATGGTCTCATACTGCTCAAGAGAATCATTTTCCTGC
AAGTGAGGTTGCATCAGAGAAGCCTGATATAGGCAACTCCTTGTCGACACAGAATTTCAATTCAGAGAACCAGTCTGGTTTCCGAAAATTCATCTGCAGA
TTTTGTGGCCTGAAATTTGACTTGCTACCTGATCTAGGCCGCCATCATCAGGCTGCTCACATGGGTCCTAATCCTGTTGGCTCTCATATCTCCAAGAAGG
GCATCCGTTTATATGCTCATAAATTGAAGTCAGGAAGACTTAGCCGTCCAAAATTCAAGAAGGGTCTCGGATCTGTAGCATATAGGATTAGGAACAGAAA
TGCTCAGAATATGAAGAGACGCATCCTGTCCTCGAACTCCATTATAGTGGAAAACCTTCGATTCAACCTAGTGCAACCGAGGCAGCTGGTCTAGGTAGAC
TGGGAGATCCCCACTGCTTTAAATATTGAAAGATATTGTTTGCTGAGATTAAAAGAAAAAAGCCCCGGCCCAGTAACTTCAACATCTTATCAATAACTCG
GATTTCTTGCTGTAAAGTAAGCCTCCAAGCATCACTT
>LE_HBa0124M10_SP6_59346 (trimmed for quality and cloning vector)
ATTCCATTATTAAGGATTACGGATAATGACCAGGATCATTGTGATCCCTTTAAGGGCAAAATTTGCTCTGAGACGTTTCCAGATGACCCTTTGCGTGGCA
CACACTGGATGGACAGCCACAAAAAGGAAGCCCAATGGCTTTTCAGGGGTTATGCTTGTGCTATCTGTCTGGATTCTTTTACTAATAAGAAAGTTTTGGA
AACTCATGTGCAGGAAAGGCACCATTCACAGTTTGTTGAAAATTGCATGCTTTTTCAGTGTATTCCGTGTACTAGCAATTTTGGGAACTCAGAGGAGTTA
TGGTCCCACGTGCTCACCGCACATCCTTCCAGTTTTAGATGGTCTCATACTGCTCAAGAGAATCATTTTCCTGCAAGTGAGGTTGCATCAGAGAAGCCTG
ATATAGGCAACTCCTTGTCGACACAGAATTTCAATTCAGAGAACCAGTCTGGTTTCCGAAAATTCATCTGCAGATTTTGTGGCCTGAAATTTGACTTGCT
ACCTGATCTAGGCCGCCATCATCAGGCTGCTCACATGGGTCCTAATCCTGTTGGCTCTCATATCTCCAAGAAGGGCATCCGTTTATATGCTCATAAATTG
AAGTCAGGAAGACTTAGCCGTCCAAAATTCAAGAAGGGTCTCGGATCTGTAGCATATAGGATTAGGAACAGAAATGCTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.976544
Expected error %
0.324016
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g23740.1 Score 226 E Value 7e-60 Identity 18.80% Align. Length 596bp (87.78%) Frame 2
68415.m02834 zinc finger (C2H2 type) family protein contains Pfam profile: PF00096 zinc finger, C2H2 type
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC17099.1| Score 226 E Value 3e-58 Identity 18.80% Align. Length 596bp (87.78%) Frame 2
putative C2H2-type zinc finger protein [Arabidopsis thaliana] ref|NP_179954.1| zinc finger (C2H2 type) family protein [Arabidopsis thaliana] pir||T02417 probable C2H2-type zinc finger protein At2g23740 [imported] - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAO32935.1| Score 177 E Value 2e-43 Identity 14.90% Align. Length 590bp (86.89%) Frame 2
SET domain protein SDG117 [Zea mays]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0124M10
Clone
Clone name
hba-124m10
LE_HBa0124M10
C02HBa0124M10
P124M10
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found