Clone Read LE_HBa0124M10_T7_59347

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0124M10_T7_59347
Primer
T7
ID from Seq. Facility
LE_HBa_124_M10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
729 trimmed for vector and quality, 917 raw
Sequence
>LE_HBa0124M10_T7_59347 (raw untrimmed)
ACACACCTGGTACCGGGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTTTTCTTTTTCCTAGTCCCTTTTTAGGGTTCCTTAGTAANAAGNAA
AGGAANNAAAAAACCCTTTAAGGGCTCATGTAGTTTTGTTATATTTAAATTTTAAGAATTTAGGGTTGAGAGTAAAANTAGATTTTTAATTAAGAATTTA
ATTATTTAGATTTTGATTGTTGATATTTTATAGTCTATTTATTGTAGTTGGCATGTATGGAATAATTGAAGGATATTTTTATATTATTATAAAGTGAANT
AAAAAATAATAGAAAATTTAAAAATAATGTGTATAATTGGTATTATTTTTATATATAAAATGAGGGTTGAGTTAATTATAATAAAGGATAGAAGAGAAAA
TATTTGAGTGAATGTTGGTTAATTAATNAATGTATATTATTATTATTATTAAATTAGTTTAATAAGATATATAAGTTTTATTGATTTTGAGTAAGGTAAT
ATTGGATATTATATTGGTTATTTTTNAAGNGAAAATGATTAAGAAAATTGTTAAATTTGAATAATTTGTGATAAGAATAGTAAAAATATAAATTAATTTT
TATTATATATATTTGATTGATGGAAGATAAATTGTNAAAGGTATAAAGAAAATGGATGATAAAAATATTATTTGTGTTATAATTAAATAAGTATGAATAA
TGTTTGTATATGGGGATAAGGTATTTGATGGGAATATATGTAATTGGAGAAATTAAGAATGTAAAATAGGTTAAGGTTTTATATATATTAAGAAAAATGG
AAATTAGTTAATTAATATTTGTTTTTTGTGGAGGTATAATTATTGTTGTAATATAGGTTGTGATAGTTAATAAGAATGAAGAATTTAATTTAAATGTATT
TTTTTTTGGATTTGAAA
>LE_HBa0124M10_T7_59347 (trimmed for quality and cloning vector)
AGCTTGTTTTCTTTTTCCTAGTCCCTTTTTAGGGTTCCTTAGTAANAAGNAAAGGAANNAAAAAACCCTTTAAGGGCTCATGTAGTTTTGTTATATTTAA
ATTTTAAGAATTTAGGGTTGAGAGTAAAANTAGATTTTTAATTAAGAATTTAATTATTTAGATTTTGATTGTTGATATTTTATAGTCTATTTATTGTAGT
TGGCATGTATGGAATAATTGAAGGATATTTTTATATTATTATAAAGTGAANTAAAAAATAATAGAAAATTTAAAAATAATGTGTATAATTGGTATTATTT
TTATATATAAAATGAGGGTTGAGTTAATTATAATAAAGGATAGAAGAGAAAATATTTGAGTGAATGTTGGTTAATTAATNAATGTATATTATTATTATTA
TTAAATTAGTTTAATAAGATATATAAGTTTTATTGATTTTGAGTAAGGTAATATTGGATATTATATTGGTTATTTTTNAAGNGAAAATGATTAAGAAAAT
TGTTAAATTTGAATAATTTGTGATAAGAATAGTAAAAATATAAATTAATTTTTATTATATATATTTGATTGATGGAAGATAAATTGTNAAAGGTATAAAG
AAAATGGATGATAAAAATATTATTTGTGTTATAATTAAATAAGTATGAATAATGTTTGTATATGGGGATAAGGTATTTGATGGGAATATATGTAATTGGA
GAAATTAAGAATGTAAAATAGGTTAAGGT

This is probably not a useful sequence.

Problems:
  • High predicted error rate
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.828845
Expected error %
7.72373
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0124M10
Clone
Clone name
hba-124m10
LE_HBa0124M10
C02HBa0124M10
P124M10
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found