Clone Read LE_HBa0124P08_T7_59487

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0124P08_T7_59487
Primer
T7
ID from Seq. Facility
LE_HBa_124_P08-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
827 trimmed for vector and quality, 911 raw
Sequence
>LE_HBa0124P08_T7_59487 (raw untrimmed)
CTCTACCCCGGTACCGCGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTACTTCTTCCATCCAACTCCCTTCAGGCCATTTGTTGTATCCCTT
TTCTTCAACACCTTTCCTCTACGTCTCAGCATCATCCCACCTTCCCGAAGAAGCATAAATATTTGCAAGAAGAGAAAGATATCCAGAACTGTCAGGTTCC
AACTCTATACAACGTGTCGCTGCGATCTCTCCAAGCTCTAAATTGTTATGCAAACTGCAACCAAGAAGCAATGCACCCCACACACCAGCATGAGGCTGTA
TTGACATGCTTTTAATCAACCCATGTGCTTCTTCTAACCGCCCTGCCCTACTTAAAAGGTCAACTACTATAGCGTAATGGTCAACTGAGGGAGAAAGACC
ATACTTCTGTAAGGAAATAAAACAACGGTATGCTTCTTCTACCATTCCAATGTGACTGTAGGCAGTCAATATCCCTGTGATTGTGACTATGTTTGGGTTA
ATTTCAGCATTCATCATCTCATCAAACAACTTGATGGCATCATTAGCCCTACCATTTATTCCACATCCCAGTATCATGGCAGTATATGCTACCAAATCTT
TCTTTTTCAAGCCGTGGAACAGCTTGTGAGCTTTATCAATACTTCCACATTTTGCATAAAGGTCGATCAAACTAGTGGCCAAGAAGTCATCCATTTGAAT
TCCAGTTTCATGAATGAACGACTCAATCCAAGAACCAAACTTTAGATCTCCCAGCTGAGAACAAGCAGAAATAGCACTTGCCAAAGTCATTTCATCAGGT
TGCAAATCTAATTGAAGCATTTCATTGAACAGCTGCAGAGCCTCTTTTGCCCGGCTGTTTTGAACATAACAAGCTATCATGGCATTATATACTACTTGAT
CTTTCTTACGA
>LE_HBa0124P08_T7_59487 (trimmed for quality and cloning vector)
AGCTTTTACTTCTTCCATCCAACTCCCTTCAGGCCATTTGTTGTATCCCTTTTCTTCAACACCTTTCCTCTACGTCTCAGCATCATCCCACCTTCCCGAA
GAAGCATAAATATTTGCAAGAAGAGAAAGATATCCAGAACTGTCAGGTTCCAACTCTATACAACGTGTCGCTGCGATCTCTCCAAGCTCTAAATTGTTAT
GCAAACTGCAACCAAGAAGCAATGCACCCCACACACCAGCATGAGGCTGTATTGACATGCTTTTAATCAACCCATGTGCTTCTTCTAACCGCCCTGCCCT
ACTTAAAAGGTCAACTACTATAGCGTAATGGTCAACTGAGGGAGAAAGACCATACTTCTGTAAGGAAATAAAACAACGGTATGCTTCTTCTACCATTCCA
ATGTGACTGTAGGCAGTCAATATCCCTGTGATTGTGACTATGTTTGGGTTAATTTCAGCATTCATCATCTCATCAAACAACTTGATGGCATCATTAGCCC
TACCATTTATTCCACATCCCAGTATCATGGCAGTATATGCTACCAAATCTTTCTTTTTCAAGCCGTGGAACAGCTTGTGAGCTTTATCAATACTTCCACA
TTTTGCATAAAGGTCGATCAAACTAGTGGCCAAGAAGTCATCCATTTGAATTCCAGTTTCATGAATGAACGACTCAATCCAAGAACCAAACTTTAGATCT
CCCAGCTGAGAACAAGCAGAAATAGCACTTGCCAAAGTCATTTCATCAGGTTGCAAATCTAATTGAAGCATTTCATTGAACAGCTGCAGAGCCTCTTTTG
CCCGGCTGTTTTGAACATAACAAGCTA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.966708
Expected error %
0.800884
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g22760.1 Score 320 E Value 6e-88 Identity 59.80% Align. Length 776bp (93.83%) Frame 2
68417.m03286 pentatricopeptide (PPR) repeat-containing protein contains Pfam profile PF01535: PPR repeat
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g66520.1 Score 236 E Value 1e-62 Identity 45.20% Align. Length 788bp (95.28%) Frame 2
68418.m08387 pentatricopeptide (PPR) repeat-containing protein contains INTERPRO:IPR002885 PPR repeats
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB79231.1| Score 320 E Value 3e-86 Identity 19.90% Align. Length 776bp (93.83%) Frame 2
predicted protein [Arabidopsis thaliana] emb|CAA16561.1| predicted protein [Arabidopsis thaliana] ref|NP_194007.1| pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] pir||T04571 hypothetical protein T12H17.150 - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_913992.1| Score 309 E Value 7e-83 Identity 18.00% Align. Length 812bp (98.19%) Frame 2
putative pentatricopeptide (PPR) repeat-containing protein [Oryza sativa (japonica cultivar-group)] dbj|BAC57819.1| putative pentatricopeptide (PPR) repeat-containing protein [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0124P08
Clone
Clone name
hba-124p8
LE_HBa0124P08
P124P08
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found