Clone Read LE_HBa0127C09_T7_59633

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0127C09_T7_59633
Primer
T7
ID from Seq. Facility
LE_HBa_127_C09-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
765 trimmed for vector and quality, 882 raw
Sequence
>LE_HBa0127C09_T7_59633 (raw untrimmed)
CCAACCTGGGTCCCGGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAGAGACTTAGGTAATTGCGTATTACTTAACTTTATTTAATTGCCAAT
TAAATAAATTTTCAAGTTGACGTATCTTCACATGCTTTTGTATAATTTCAACAAAAATCAAAATTAAATTATTGAGAATATAATATGTTTGCAGGTATCA
GATTCGAATAATATAATTGGCATTTATAATGCAATTTGCACTTTGAAAATTATACTCTGATTGTTGGAATGTGAGGTGACCAATAAATTTATAGTGAGGA
TTTGTCTGTCCTCTGGCTATGTTCTGATTTAATGCTTGTATATAAAAGGGGGCAAATTATCTCGTGTTCACGTAAGGTTCGAAAAAATAATAATTAAAAA
GTTATAATGTAAATAATTTATTGAGTATAATTTTGTTGTTGTTTGATATGATATTTAAACTTTTTTTGTTTATTTAATTTTTTTTTATATTTATATTCTT
CGATTTTGAATGTATATAAATATAAAACTTCAATTATTATAAAATTAAATAAACAGACACATACGTCTTACGAGTCGAAATTATAGTCACCAGGAACCAT
TTGACAAAGGCTGGCAAATTTGTTTGATAAAATTAGTACAACACACATGTGATACAATGATAAGTTGGCATGACATTATACACCCAAACCTACAACCTCC
TTTTTTTTTCTACTAATTAATTAAATTACCCTAAGCAACTTTTATTTACTCCAACAATAAATAAAATTATGGAAATAAAAATAACATGTATACTCAAAAT
ATCACCTCAAAAAACAAAACATCCCCCGAGGCTCGTCTGAATTTTGTACGTCCTTCCATCGATCTGAATACTTGCGAAATCC
>LE_HBa0127C09_T7_59633 (trimmed for quality and cloning vector)
AGCTTAGAGACTTAGGTAATTGCGTATTACTTAACTTTATTTAATTGCCAATTAAATAAATTTTCAAGTTGACGTATCTTCACATGCTTTTGTATAATTT
CAACAAAAATCAAAATTAAATTATTGAGAATATAATATGTTTGCAGGTATCAGATTCGAATAATATAATTGGCATTTATAATGCAATTTGCACTTTGAAA
ATTATACTCTGATTGTTGGAATGTGAGGTGACCAATAAATTTATAGTGAGGATTTGTCTGTCCTCTGGCTATGTTCTGATTTAATGCTTGTATATAAAAG
GGGGCAAATTATCTCGTGTTCACGTAAGGTTCGAAAAAATAATAATTAAAAAGTTATAATGTAAATAATTTATTGAGTATAATTTTGTTGTTGTTTGATA
TGATATTTAAACTTTTTTTGTTTATTTAATTTTTTTTTATATTTATATTCTTCGATTTTGAATGTATATAAATATAAAACTTCAATTATTATAAAATTAA
ATAAACAGACACATACGTCTTACGAGTCGAAATTATAGTCACCAGGAACCATTTGACAAAGGCTGGCAAATTTGTTTGATAAAATTAGTACAACACACAT
GTGATACAATGATAAGTTGGCATGACATTATACACCCAAACCTACAACCTCCTTTTTTTTTCTACTAATTAATTAAATTACCCTAAGCAACTTTTATTTA
CTCCAACAATAAATAAAATTATGGAAATAAAAATAACATGTATACTCAAAATATCACCTCAAAAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.899874
Expected error %
1.40657
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0127C09
Clone
Clone name
hba-127c9
LE_HBa0127C09
P127C09
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found