Clone Read LE_HBa0127E21_T7_59753

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0127E21_T7_59753
Primer
T7
ID from Seq. Facility
LE_HBa_127_E21-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
427 trimmed for vector and quality, 746 raw
Sequence
>LE_HBa0127E21_T7_59753 (raw untrimmed)
TTTTTTTTATTTTACCGATTTCACAAACAAATGAGTTCTTTTTTAACTTTAAACATATCATTTTATCTTTACTGTAATTATTTATAACTATACAAATATT
TTTAATTTGTTTTATCCTTTAATCCAGACTCACACACACAAAATTCTAATGTAAATTTTGTTTTCTTTATTGAAGATGGTCAGCGATTGCTATTCACTTA
CCAGGAAGATCAGACAATGAAATAAAAAATCATTGGCACACATCTCTCAAGAAAAGATCAAAACATGAATTAACAATATCTAATGGAAAAAAGAGAGAGG
CAAGTAATGTCAATCAAAAAAGTGATGAAGACCAAAATATTACACCAAATGAATCATATAGTGAAGTTTCTCCTTGTGTTACAATTGACCAATTTATGGA
AGATATTATGGATGGAAAATGTGAGATGATTCAAGAAAAATCATTTGAAGAATGCATTGGAAATTTTTGGACAGAACCATTTTTAATAGATAGTTTTAAT
AGTACTACTAATTAATAATAATGAATTTTGTGTGCCTTTAGAATTTGAGTATGGACTATTTATATCTCCGCTTTCTCCCCTCAAGTGTTATCATGTATCT
CTATGTCATAAATCTAAGTGTTATTTTTGTGCAAAAAATGTCCAAACGATTTATGTAATTTAAAGTTAGATTTAACTGATGCTTCATTTATATAATATTG
TAGTCAGTAATATGCACGCTTAAACATCAGTCCTAATAAATAGGTC
>LE_HBa0127E21_T7_59753 (trimmed for quality and cloning vector)
TCATTTTATCTTTACTGTAATTATTTATAACTATACAAATATTTTTAATTTGTTTTATCCTTTAATCCAGACTCACACACACAAAATTCTAATGTAAATT
TTGTTTTCTTTATTGAAGATGGTCAGCGATTGCTATTCACTTACCAGGAAGATCAGACAATGAAATAAAAAATCATTGGCACACATCTCTCAAGAAAAGA
TCAAAACATGAATTAACAATATCTAATGGAAAAAAGAGAGAGGCAAGTAATGTCAATCAAAAAAGTGATGAAGACCAAAATATTACACCAAATGAATCAT
ATAGTGAAGTTTCTCCTTGTGTTACAATTGACCAATTTATGGAAGATATTATGGATGGAAAATGTGAGATGATTCAAGAAAAATCATTTGAAGAATGCAT
TGGAAATTTTTGGACAGAACCATTTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.89734
Expected error %
0.836205
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g31180.1 Score 63 E Value 5e-11 Identity 14.20% Align. Length 239bp (55.97%) Frame 1
68415.m03807 myb family transcription factor (MYB14) similar to myb-related transcription factor GI:1370140 from [Lycopersicon esculentum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0127E21
Clone
Clone name
hba-127e21
LE_HBa0127E21
C12HBa0127E21
P127E21
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found