Clone Read LE_HBa0134D19_SP6_60468

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0134D19_SP6_60468
Primer
SP6
ID from Seq. Facility
LE_HBa_134_D19-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
623 trimmed for vector and quality, 849 raw
Genbank Accession
Sequence
>LE_HBa0134D19_SP6_60468 (raw untrimmed)
GGGCCAGTTTAATTTAATTTTGTAGATAAAGCAAGTAAAAAATGTCACATATATACGTGCAAAGCAAGTTGATTACGCCCTTCCGTTTGAGTTCTATTTT
GTCTTGTTTTTGGTTAACCTTAAATCTAGTTGACGCTTATCTTTAAATTTTTTTAATTGCATCTAAAAGTTTTGGTGTCATCTTTTCAAACTGTAATATA
AAATTGTGAAAATTCTAAATTCGATAAGTGTTTCCTTACAGATAACTAGTGTCCGGTTCCAAAGGTATTGTATCATTTTTAATTTTATCATGAATATTAT
TTTTTTCAATGACATCTACAATTTCTTCTAAGCTTTGAACTTTTTGAACATGTATCATTTTCACCCATCCAACAAGTTATTAACATCAATTTTATTGTGC
TAACCGAGATCATTAATCATGACATCAAGTTAATGAATGACGTTTTTACAAGTAGATTTATTTAAAATCTATGAGAATTCATCTCCTAATGAATTTTACT
TTTACTGTGTCAAATCTGTTTTTAAATTAATAAAAATTAATTTATCGATTAAATAATACATCTATAAAACAATACAGTAATATTTATGGTCCATCTTATA
TTAATTTAATGATGTGTTATTGTATTTGACAAACATTTCAAAATCATTGAATAAGCCCCATTTTCTTGTTTTTTGAATTAAAATATATATTACCAAGAAA
TGTCTAAAGCTACAACAAATTCAAACTTGTTTGATTCATAAAATACTAAAAGAAAATTGTTTTAATCCTAAATATATTATTATAAATATAGATTTCACTT
TGAATTTGCTCAACAAAAAAATAAAATCTACCTACTTATAAAATTTGGN
>LE_HBa0134D19_SP6_60468 (trimmed for quality and cloning vector)
GCAAGTAAAAAATGTCACATATATACGTGCAAAGCAAGTTGATTACGCCCTTCCGTTTGAGTTCTATTTTGTCTTGTTTTTGGTTAACCTTAAATCTAGT
TGACGCTTATCTTTAAATTTTTTTAATTGCATCTAAAAGTTTTGGTGTCATCTTTTCAAACTGTAATATAAAATTGTGAAAATTCTAAATTCGATAAGTG
TTTCCTTACAGATAACTAGTGTCCGGTTCCAAAGGTATTGTATCATTTTTAATTTTATCATGAATATTATTTTTTTCAATGACATCTACAATTTCTTCTA
AGCTTTGAACTTTTTGAACATGTATCATTTTCACCCATCCAACAAGTTATTAACATCAATTTTATTGTGCTAACCGAGATCATTAATCATGACATCAAGT
TAATGAATGACGTTTTTACAAGTAGATTTATTTAAAATCTATGAGAATTCATCTCCTAATGAATTTTACTTTTACTGTGTCAAATCTGTTTTTAAATTAA
TAAAAATTAATTTATCGATTAAATAATACATCTATAAAACAATACAGTAATATTTATGGTCCATCTTATATTAATTTAATGATGTGTTATTGTATTTGAC
AAACATTTCAAAATCATTGAATA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.896966
Expected error %
0.410527
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38752.1| Score 69 E Value 7e-11 Identity 15.90% Align. Length 251bp (40.29%) Frame 3
hypothetical protein PGEC568H16.8 [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0134D19
Clone
Clone name
hba-134d19
LE_HBa0134D19
P134D19
Clone type
BAC
Contamination
none
Estimated length
123,059
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found