Clone Read LE_HBa0134D19_T7_60469

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0134D19_T7_60469
Primer
T7
ID from Seq. Facility
LE_HBa_134_D19-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
705 trimmed for vector and quality, 867 raw
Genbank Accession
Sequence
>LE_HBa0134D19_T7_60469 (raw untrimmed)
TTAAACTGGGACCCGCGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATTCACAAATGTTCCATTTAGCCTTAAAGCCCCCCCATTTCCATCTG
AAACTTCTACTCGAGCCCTTATTGAGGCGGGGAATTTTCGATGAACATCTTGTTTGTGTAGTGCATACAGAGATAATTACAATTTTTATTCAAGTGTTAA
AGGCTTAAAGCTCTATGTTGTTATTCAGGGAAAGAACAGGATAGTGTAATCCTTCTGTAGTAAGTTGGAACTTATTCTTGTAATTGATGTATTACATCTA
CAGCTTTGATTTCTCCCTTTGGAGATACAAAGATTGAATCATTTAGCCTAACATTTACACAATGAGATCAATATACAATTGCTTTGAACCTCTTCTCTAC
ACTTTTGATTCGCGATCAATGATGATTATATTCTATGCTCAAGCATTTGTGTTAAAGGAAAAACAAATGGTCGCCATCTCTGACAACATCAATGTCATCT
ATTTCAGCATCCTCTGCATTTACAGCTCTCTGGAAATCACAACCTCCAAATCTTTGACCTGCAGTTGGAGGAAGCTCCAGAGTGAGAAAGAATGATCGGC
GTTCTTTCAACTTTCACAAAATGAAAGGTAATTACCTGCTACTCTGAAGAGCTCTTGTAGTGAATCAAGCAGAATGATTAGTTTCCCAAACTGGTGAATG
CATGGTTCTTTCTCATGTGAATGGTGATTCTCTTCCTATGGTGGGAGATTTTGTACCTTGAAAGCCCATTCACCTGGTACCACATGAGGGTCTTTAAAGC
AAAAATCGTAACAAATGGGACCTCATAGTTACATTTAACACATTTCTTCCTCCTCCTGGCCCCCTCT
>LE_HBa0134D19_T7_60469 (trimmed for quality and cloning vector)
AGCTTATTCACAAATGTTCCATTTAGCCTTAAAGCCCCCCCATTTCCATCTGAAACTTCTACTCGAGCCCTTATTGAGGCGGGGAATTTTCGATGAACAT
CTTGTTTGTGTAGTGCATACAGAGATAATTACAATTTTTATTCAAGTGTTAAAGGCTTAAAGCTCTATGTTGTTATTCAGGGAAAGAACAGGATAGTGTA
ATCCTTCTGTAGTAAGTTGGAACTTATTCTTGTAATTGATGTATTACATCTACAGCTTTGATTTCTCCCTTTGGAGATACAAAGATTGAATCATTTAGCC
TAACATTTACACAATGAGATCAATATACAATTGCTTTGAACCTCTTCTCTACACTTTTGATTCGCGATCAATGATGATTATATTCTATGCTCAAGCATTT
GTGTTAAAGGAAAAACAAATGGTCGCCATCTCTGACAACATCAATGTCATCTATTTCAGCATCCTCTGCATTTACAGCTCTCTGGAAATCACAACCTCCA
AATCTTTGACCTGCAGTTGGAGGAAGCTCCAGAGTGAGAAAGAATGATCGGCGTTCTTTCAACTTTCACAAAATGAAAGGTAATTACCTGCTACTCTGAA
GAGCTCTTGTAGTGAATCAAGCAGAATGATTAGTTTCCCAAACTGGTGAATGCATGGTTCTTTCTCATGTGAATGGTGATTCTCTTCCTATGGTGGGAGA
TTTTG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.954792
Expected error %
1.07276
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA56175.1| Score 71 E Value 8e-18 Identity 82.90% Align. Length 280bp (39.72%) Frame 3
K+ channel inward rectifying [Solanum tuberosum] pir||S55349 potassium channel protein KST1 - potato
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0134D19
Clone
Clone name
hba-134d19
LE_HBa0134D19
P134D19
Clone type
BAC
Contamination
none
Estimated length
123,059
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found