Clone Read LE_HBa0134O15_SP6_60988

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0134O15_SP6_60988
Primer
SP6
ID from Seq. Facility
LE_HBa_134_O15-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
674 trimmed for vector and quality, 859 raw
Genbank Accession
Sequence
>LE_HBa0134O15_SP6_60988 (raw untrimmed)
GGGCAAGAATTTTTAGGGTGAAAGACTAATATATTCATCTCACTCATCTCCTTGAAAATCTCATAAATATCATCTTTCTATAAAGGCCCATTGTTTAGAG
AAGTTCTGGAAAGTTTTCCCTTGATCTCTTCCCAAAGACCCAAGATGTACTTCCTTTTGTGATTAAACACCACACCTCTTCCTTCGAAGACAGACATAGC
ACCATTTATCTTGGGAAAAACTCGGGAAAGCTCATTTGAGTTAGGAGCCAACCTTTTTAAAGTTTGGCCACGAGAAGTAGACGGTGACTCTTGATCTTTC
TCGATATTTGAAATTGGTTTTGCCTTAGGTCTCAATATTGCGGTAGACTCTTCGCTAACTTGTGGCCTCTCACGCGGTGATCCTTGTAAATGTCCATCAG
CATCAACCTACAAACGAAAGGGGCAGGTTAGCAAGGTCATTTCATTTTATTTATTTATTTATTTTTAAAAATAAATAAATAAATATATATATATATATAT
ATACATACCTTGTTACTCTGAATTGTCAATGATCTAGAAGGATTATCAACACTTCGGACTTCTACAATTTCAGCCCCAGATAGTTCAATTCTTTGCCTCT
TCCAACATCGATCCTTGCTAGTTTTGCTTTTTTCTTGAAGGGGCTATTTACTAGAGAAGAGAAATAGGGGGGATTTCTCTTTATCGGTAGGAGTATGAAC
CAGTTCTTTCTTAGATGCCTTAAAAAAATTAAGCTTCTTACTTTGATGTTGGGGAGAAAGTGGTGGCCTGACTTTTGAAAATGTTTTCTCGATATCTTGA
ATTTTGTCTTCAAAAGGGTAACAAATACAGACCCACCTTTTTCCCCATAACATCCAATT
>LE_HBa0134O15_SP6_60988 (trimmed for quality and cloning vector)
ATATATTCATCTCACTCATCTCCTTGAAAATCTCATAAATATCATCTTTCTATAAAGGCCCATTGTTTAGAGAAGTTCTGGAAAGTTTTCCCTTGATCTC
TTCCCAAAGACCCAAGATGTACTTCCTTTTGTGATTAAACACCACACCTCTTCCTTCGAAGACAGACATAGCACCATTTATCTTGGGAAAAACTCGGGAA
AGCTCATTTGAGTTAGGAGCCAACCTTTTTAAAGTTTGGCCACGAGAAGTAGACGGTGACTCTTGATCTTTCTCGATATTTGAAATTGGTTTTGCCTTAG
GTCTCAATATTGCGGTAGACTCTTCGCTAACTTGTGGCCTCTCACGCGGTGATCCTTGTAAATGTCCATCAGCATCAACCTACAAACGAAAGGGGCAGGT
TAGCAAGGTCATTTCATTTTATTTATTTATTTATTTTTAAAAATAAATAAATAAATATATATATATATATATATACATACCTTGTTACTCTGAATTGTCA
ATGATCTAGAAGGATTATCAACACTTCGGACTTCTACAATTTCAGCCCCAGATAGTTCAATTCTTTGCCTCTTCCAACATCGATCCTTGCTAGTTTTGCT
TTTTTCTTGAAGGGGCTATTTACTAGAGAAGAGAAATAGGGGGGATTTCTCTTTATCGGTAGGAGTATGAACCA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.95901
Expected error %
0.336732
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0134O15
Clone
Clone name
hba-134o15
LE_HBa0134O15
P134O15
Clone type
BAC
Contamination
none
Estimated length
48,084
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found